View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_485 (Length: 244)

Name: NF10145A_low_485
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_485
NF10145A_low_485
[»] chr1 (1 HSPs)
chr1 (1-238)||(4082875-4083112)
[»] chr3 (1 HSPs)
chr3 (151-194)||(48203029-48203072)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 4082875 - 4083112
Alignment:
1 agaacatataactaattgtcagcaatagaagtcacttacatagataatatcttttgtcatgggaagaagatcgccctatgacaatgccaataattcattg 100  Q
    |||||||| ||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||     
4082875 agaacatagaacaaattgtcagcaatagaaatcacttacatcgataatatcttttgtcatgggaagaagattgccctatgacaatgccaacaatttatta 4082974  T
101 ataggtccatttctatatttttcattctccctaataggattagcaacaagcattgccataatcacaactctatgtagtgttcgatttcgaagaagaaaat 200  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4082975 ataggtccatttctaaatttttcattctccctaataggattagcaacaagcattgccataatcacaactctatgtagtgttcgatttcgaagaagaaaat 4083074  T
201 tgacgccgccccctacaacaccgatatcaaacaccaaa 238  Q
    ||||||||||||||||||||||||||||||||||||||    
4083075 tgacgccgccccctacaacaccgatatcaaacaccaaa 4083112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 194
Target Start/End: Complemental strand, 48203072 - 48203029
Alignment:
151 cattgccataatcacaactctatgtagtgttcgatttcgaagaa 194  Q
    ||||||||||||||||||| |||||||| ||||||| |||||||    
48203072 cattgccataatcacaactatatgtagttttcgattccgaagaa 48203029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University