View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_486 (Length: 244)
Name: NF10145A_low_486
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_486 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 49825338 - 49825101
Alignment:
| Q |
1 |
tatttaaggttggaattacggatgggaacttaatgcataattggcgcaactatgcggtcaaaaggacatctgatgaatcaatttgtgactcttcacaaca |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49825338 |
tatttaaggttgaaattacggatgggaacttaatgcataattggcgcaactatgctgtcaaaaggacatctgatgaatcaatttgtgactcttcacaaca |
49825239 |
T |
|
| Q |
101 |
ttacaatgacgaatatcctgctgatctggatttgttcatagacnnnnnnnntgttgtttaaagttgagataactgatggcaacttgaagcatggatggcg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49825238 |
ttacaatggcgaatatcctgctgatctggatttgttcatagac-aaaaaaatgttgtttaaagtcgagataactgatggcaacttgaagcatggatggcg |
49825140 |
T |
|
| Q |
201 |
taactaagctgtgaagcgggtgtatgatgatgtccatct |
239 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |||| |
|
|
| T |
49825139 |
taactaagttgtgaagcgggtgtctgatgatgtcgatct |
49825101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 67
Target Start/End: Original strand, 232593 - 232658
Alignment:
| Q |
3 |
tttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
67 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
232593 |
tttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
232658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 14584782 - 14584717
Alignment:
| Q |
3 |
tttaaggttggaattacggatgggaacttaatgcata-attggcgcaactatgcggtcaaaaggac |
67 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| | ||||||||| ||| | ||||||||||| |
|
|
| T |
14584782 |
tttaaggttgaaattacggatgggaacttgatgcagagcttggcgcaattattctgtcaaaaggac |
14584717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University