View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_494 (Length: 243)
Name: NF10145A_low_494
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_494 |
 | |
|
| [»] scaffold0774 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0774 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: scaffold0774
Description:
Target: scaffold0774; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 2840 - 2649
Alignment:
| Q |
1 |
gacttacattcattttagtcgataaaagtgagtgttagaatgagtgatttttcctttttgaaaaaatatttgtaatatgattcgtaatatgtgttgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2840 |
gacttacattcattttagtcgataaaagtgagtgttagaatgagtcgtttttcctttttgaacaaatatttgtaatatgattcgtaatatgtgttgataa |
2741 |
T |
|
| Q |
101 |
cttgatactattggtaaatat-------------actgacagcgccatggacgatcgagtttcaccattgcaaaactccaatggttccattc |
179 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2740 |
cttgatactattggtaaatataatcagtagttgcagtgacagcgccatggatgatcgagtttcaccatcgcaaaactccaacggttccattc |
2649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0774; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 199 - 237
Target Start/End: Complemental strand, 2655 - 2617
Alignment:
| Q |
199 |
tccattcaaccaccatcctgtcactctaccaacaccaaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2655 |
tccattcaaccaccatcctgtcactctaccaacaccaaa |
2617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University