View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_498 (Length: 243)
Name: NF10145A_low_498
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_498 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 243
Target Start/End: Original strand, 34142215 - 34142451
Alignment:
| Q |
7 |
tggtggtctgaaaaccacaaatatcaatatgcaaaacatgttagcaacttagcatttgatcagatggaaaataacaagcattcaaaaatcattgaactag |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142215 |
tggtgttctgaaaaccacaaatatcaatatgcaaaacatgttagcaacttagcatttgatcagatggaaaataacaagcattcaaaaatcattgaactag |
34142314 |
T |
|
| Q |
107 |
ctctactcatttgcaaccataatcttgctaccaaaaacccagtttgtgcggcaaaatcaattaattgtataaactatataataatgtataaacaagctca |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142315 |
ctctacgcatttgcaaccataatcttgctaccaaaaacccagtttgtgaggcaaaatcaattaattgtataaactatataataatgtataaacaagctca |
34142414 |
T |
|
| Q |
207 |
aacagggacggttcatttaatagtcattatgagtgag |
243 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
34142415 |
aagagggacggttaatttaatagtcattatgagtgag |
34142451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University