View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_50 (Length: 421)
Name: NF10145A_low_50
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 6e-84; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 205 - 405
Target Start/End: Complemental strand, 6119024 - 6118831
Alignment:
Q |
205 |
gacaagtgaatagaatcaggtggtcgtgtaaagcagattaattgcatacaatattactagattcatatccagtgattatttcatataatttttcgaaggt |
304 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| | |
|
|
T |
6119024 |
gacaagtgaatagaatcaggtggtcgtgtaaagcagattaattgcatacaatattactagattcatatccagtgattatttcatacaattttttgaagat |
6118925 |
T |
 |
Q |
305 |
taaattcatacttgaaaataatagttcaagaatatatacctaaataaatgagcagatattacaagaacagatggatgctaaacaaccaaaaactgatgat |
404 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6118924 |
taaattcatacttgaaaataatagttcaagaatatatacct----aaatgagcaga---tacaagaacagatggatgctaaacaaccaaaaactgatgat |
6118832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 35 - 104
Target Start/End: Original strand, 32623541 - 32623610
Alignment:
Q |
35 |
acaaaataaatccatagactaaagattaaggttttgaaaataagattgatcggccaatcatttagttgat |
104 |
Q |
|
|
||||||||||| |||| || || ||||||||||| ||||||||||||||||| |||||| ||||||||| |
|
|
T |
32623541 |
acaaaataaattcatacacaaataattaaggttttcaaaataagattgatcggtcaatcaattagttgat |
32623610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 6150246 - 6150160
Alignment:
Q |
18 |
acatcaaaatcatatagacaaaataaatccatagactaaagattaaggttttgaaaataagattgatcggccaatcatttagttgat |
104 |
Q |
|
|
|||||||||||| | |||||||||||| ||| || ||||| |||||||||||| |||||||| ||| | ||||| ||||||||| |
|
|
T |
6150246 |
acatcaaaatcacacggacaaaataaatagatacacaaaagactaaggttttgaatataagatttatcagtgaatcaattagttgat |
6150160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University