View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_501 (Length: 243)
Name: NF10145A_low_501
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_501 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 46869531 - 46869305
Alignment:
Q |
9 |
ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46869531 |
ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc |
46869432 |
T |
 |
Q |
109 |
ttgcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaacccagcccccgatatatcacagatgca |
208 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
T |
46869431 |
tagcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaaccaagcccccgatatatcacagatgta |
46869332 |
T |
 |
Q |
209 |
aatgacaaataatatcatatctttgtt |
235 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
46869331 |
aatgacaaataatatcatatctttgtt |
46869305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University