View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_501 (Length: 243)

Name: NF10145A_low_501
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_501
NF10145A_low_501
[»] chr4 (1 HSPs)
chr4 (9-235)||(46869305-46869531)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 46869531 - 46869305
Alignment:
9 ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46869531 ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc 46869432  T
109 ttgcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaacccagcccccgatatatcacagatgca 208  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |    
46869431 tagcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaaccaagcccccgatatatcacagatgta 46869332  T
209 aatgacaaataatatcatatctttgtt 235  Q
    |||||||||||||||||||||||||||    
46869331 aatgacaaataatatcatatctttgtt 46869305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University