View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_504 (Length: 243)
Name: NF10145A_low_504
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_504 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 57 - 228
Target Start/End: Complemental strand, 48632997 - 48632842
Alignment:
| Q |
57 |
atagtgcttaactttccaatccaaattatactcttctcataatgccttttgtctttcatgaatgccattgcaattactttgctggctttatctgaacaca |
156 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48632997 |
atagtgcttaactttccaatctaaattatactcttctcataatgccttttgtctttcatgaatgccattgcaattac----------------gaacaca |
48632914 |
T |
|
| Q |
157 |
ttgtcttgatcaagatctagatttaaaagtaaaaaatcttacgattttgcggtcctactcaccctctctgat |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48632913 |
ttgtcttgatcatgatctagatttaaaagtaaaaaatcttacgattttgcggtcctactcaccctctctgat |
48632842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University