View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_509 (Length: 242)
Name: NF10145A_low_509
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_509 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38737470 - 38737716
Alignment:
| Q |
1 |
ggtggtggtagcaacggcaagagttcccgtagtggtcgaatgtctaggttggttgattatctcaaaaacttgaatgagaacactgatgaggtataagttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38737470 |
ggtggtggtagcaacggcaagagttcccgtagtggtcgaatgtctaggttggttgattatctcaaaaacttgaatgagaacactgatgaggtataagttc |
38737569 |
T |
|
| Q |
101 |
nnnnnnnn---------ctctctctcttgtaatggaccaatgaaaaatgatactacgtattgcttctttattatacttgtattcttatttcagttcaatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38737570 |
tttttttttttttttctctctctctcttgtaatggaccaatgaaaaatgatactacgtattgcttctttattatacttgtattcttatttcagttcaatt |
38737669 |
T |
|
| Q |
192 |
taacaaatagataccgtcttttatttacagtttgatgtccatctcat |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
38737670 |
taacaaatagatactgtcttttatttacagtttgatgttcatctcat |
38737716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University