View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_514 (Length: 242)

Name: NF10145A_low_514
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_514
NF10145A_low_514
[»] chr8 (1 HSPs)
chr8 (173-221)||(3116377-3116425)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 3116425 - 3116377
Alignment:
173 cacttgttttgatggaaaatctcaaagcaggggtaaaagacgcatctct 221  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||    
3116425 cacttgttttgatggaaaatctcaaagcagaggtaaaagacgcatctct 3116377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University