View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_514 (Length: 242)
Name: NF10145A_low_514
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_514 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 3116425 - 3116377
Alignment:
Q |
173 |
cacttgttttgatggaaaatctcaaagcaggggtaaaagacgcatctct |
221 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
3116425 |
cacttgttttgatggaaaatctcaaagcagaggtaaaagacgcatctct |
3116377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University