View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_534 (Length: 237)
Name: NF10145A_low_534
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_534 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 21445324 - 21445092
Alignment:
| Q |
1 |
catatagttgatatcttaatgtgttgagtggagatgtggtgttctcatctcatgttggtcctagattattgacttgttgttgctttcgatagtcacgtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
21445324 |
catatagttgatatcttaatgtgttgagtggagatgcggtgttctcatctcatgttggtcctagattattgacttgttcttgcttccgatagtcacgtag |
21445225 |
T |
|
| Q |
101 |
acttacactttatgaaagattgttgagtcaagtgattagtcataaatctattatgaatgaactaaatgttgaatataaatagatgtaactcatacactta |
200 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445224 |
acttacattttatgagagattgttgagtcaagtgattagtcataaatctattatgaatgaactaaatgttgaatataaatagatgtaactcatacactta |
21445125 |
T |
|
| Q |
201 |
accacttaaaattttatgtgaagatgtgatgtc |
233 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
21445124 |
atcacttaaaattttatgtgaagatgtgatgtc |
21445092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University