View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_535 (Length: 237)
Name: NF10145A_low_535
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_535 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 237
Target Start/End: Original strand, 4603771 - 4604003
Alignment:
| Q |
5 |
agtttggtgtttgattttgttgttgagtagccttcattatcactgtggtgctttttctctgctgatgaagatgtttttggattttggctacaaaaatttg |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4603771 |
agtttggtgtttgtttttgttgttgagtagccttcattatcactgtggtgctttttctctgctgatgaagatgtttttggattttggctacaaaaatttg |
4603870 |
T |
 |
| Q |
105 |
atgatagatgtctttgttgcatctggttttgttgtttgttggttggagcatcttggttgaagagatggagcacatggtgccttgctgtttgattttctcg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
4603871 |
atgatagatgtctttgttgcatctggttttgttgtttgttggttggagcatcttggttgcagacatggagctcatggcgccttgctgtttgattttctcg |
4603970 |
T |
 |
| Q |
205 |
tgttgcattctcctgtttatgaggacttgctga |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4603971 |
tgttgcattctcctgtttatgaggacttgctga |
4604003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University