View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_536 (Length: 237)
Name: NF10145A_low_536
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_536 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 23524275 - 23524057
Alignment:
| Q |
8 |
agttcaatccctacatcagtggcgccctcatgtctttcctagccattttcattttcatccatcttctccccttcatcattaccatggtaaccttctactt |
107 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23524275 |
agttcaaaccctacatcagtggggccctcatttctttcctagccattttcattttcatccatcttctccccttcatcattaccatggtaaccttctactt |
23524176 |
T |
|
| Q |
108 |
tccactctttttctctactgccctgtttgccgtcgtcatcttcgttttgacaaaaatagccccacccaacattgaccctattcatgtccctagattagct |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
23524175 |
tccactctttttctctactgccctatttgccgtcgtcatcttcgttttgacaaagatcaccccacccaacaatgaccctattcatgtccctagactagct |
23524076 |
T |
|
| Q |
208 |
gaagaaatcctcgagtatt |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23524075 |
gaagaaatcctcgagtatt |
23524057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University