View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_539 (Length: 236)
Name: NF10145A_low_539
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_539 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 32724768 - 32724984
Alignment:
Q |
9 |
gactgagatgaaaaagcaacttaatttattattttgagtgttca-----tttcactagtgtatgttctatgtaatataggtctaggttttattgtatcta |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32724768 |
gactgagatgaaaaagcaacttaatttattattttgagtgttcatttcatttcactagtgtatgttctatgtaatataggtctaggttttattgtatcta |
32724867 |
T |
 |
Q |
104 |
ggagcagctagtgaatttgtaacaattcaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttggacgtattactggtt |
203 |
Q |
|
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
32724868 |
ggagcagctgttgaatttgtaacaattgaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttgcacgtattactggtt |
32724967 |
T |
 |
Q |
204 |
tatgcggacagcatgat |
220 |
Q |
|
|
||||||||||||||||| |
|
|
T |
32724968 |
tatgcggacagcatgat |
32724984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University