View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_541 (Length: 235)
Name: NF10145A_low_541
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_541 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 235
Target Start/End: Original strand, 29801648 - 29801876
Alignment:
| Q |
7 |
tttggtgttgtattttgtgtctatatgtcggtatgtctgtttatgtgcttcatatttatttgtttggttttggtctttgctcttttggggaaaaattgaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29801648 |
tttgctgttgtattttgtgtctatatgtcggtatgtctgtttatgtgcttcatatttatttgtttggttttggtctttgctcttttggggaaaaattgaa |
29801747 |
T |
|
| Q |
107 |
actagaataagctgaatgatcgctagtaggtagacaatatccttcatgcataaagagactcaagttgttttagtgctaactaaactagtttgttgttatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29801748 |
actagaataagctgaatgatcgctagtaggtagacaatatcattcatgcataaagagactcaagttgttttagtgctaactaaactagtttgttgttatc |
29801847 |
T |
|
| Q |
207 |
ttttaatatttattcgcttttataacatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29801848 |
ttttaatatttattcgcttttataacatt |
29801876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University