View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_548 (Length: 234)
Name: NF10145A_low_548
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_548 |
 | |
|
| [»] scaffold0092 (1 HSPs) |
| | |
|
| [»] scaffold0053 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0092 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 42433 - 42646
Alignment:
| Q |
16 |
acatcagattgactcagtggtcacaatgctaaagcagaagcttcagacgcaacccctgtaagtttttattcttgttttgttcagttttgaaaaattaaac |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
42433 |
acatcagattgactcagtggtctcaatgctaaagcagaagcttcagacgcaaccc----------------ttgttttgttcagttttgaaaaattgaac |
42516 |
T |
|
| Q |
116 |
ggcatattttttgtcaacccatttacctgattgttgtctttaacttg-------------------tcaactttgacaaatgggaggtttttgttaatga |
196 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42517 |
ggcatatttattgtcaacccgtttacctgattgttgcctttaacttgtcattgagtagctactggatcaactttgacaaatgggaggtttttgttaatga |
42616 |
T |
|
| Q |
197 |
tgatcgcacacacaccttcatctcagtcga |
226 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |
|
|
| T |
42617 |
tgatcgcacacgcaccttcctctcagtcga |
42646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 8242 - 8459
Alignment:
| Q |
16 |
acatcagattgactcagtggtcacaatgctaaagcagaagcttcagacgcaacccctgtaagtttttattcttgttttgttcagttttgaaaaattaaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
8242 |
acatcagattgactcagtggtcacaatgctaaaacagaagcttcagacacaatccctgtaagtttttattctt----------gttttgaaaaattgaac |
8331 |
T |
|
| Q |
116 |
ggcatattttttgtcaacccatttacctgattgttgtctttaacttgtca---------------------actttgacaaatgggaggtttttgttaat |
194 |
Q |
| |
|
| |||||||||||||| || ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8332 |
agaatattttttgtcaa-ccgtttacctgattgttgcctttaacttgtcatcttgagcagctactggatcgactttgacaaatgggaggtttttgttaat |
8430 |
T |
|
| Q |
195 |
gatgatcgcacacacaccttcatctcagt |
223 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |
|
|
| T |
8431 |
gatgatcgcacacgcaccttcctctcagt |
8459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University