View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_550 (Length: 234)
Name: NF10145A_low_550
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_550 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 219
Target Start/End: Complemental strand, 19559209 - 19558999
Alignment:
| Q |
9 |
tggacatcacaaattcaaaaccgttcctgcacatgaatgaaaatacttccaacggccaacacaactgtggaagtgaccgaaagagaggaaagttcaatag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19559209 |
tggacatcacaaattcaaaaccgttcctgcacatgaatgaaaatacttccaacggccaacacaactgtggaagtgaccgaaagagaggaaagttcaatag |
19559110 |
T |
 |
| Q |
109 |
aaaaacccacaacattgtcattatatggtgtcatggcaacatttgtgttgtcaaaaatatcatttctgataaatattctttagtgtcatcttttgaagta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19559109 |
aaaaacccacaacattgtcattatatggtgtcatggcaacatttgtgttgtcaaaaatatcatttctgataaatattctttagtgtcatcttttgaagta |
19559010 |
T |
 |
| Q |
209 |
gcctggttcag |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
19559009 |
gcctggttcag |
19558999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University