View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_551 (Length: 234)
Name: NF10145A_low_551
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_551 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 29336400 - 29336161
Alignment:
| Q |
8 |
caatgatccgagtgcgactttgaaatcagaattctcacataatcagcactcaaaccaacaatctaaagataatattgatttggacaagataatggaagat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29336400 |
caatgatccgagtgcgactttgaaatcagaattctcacataatcagcactcaaaccaacaatctaaagataatattgatttggacaagataatggaagat |
29336301 |
T |
 |
| Q |
108 |
ttttgtcaaattgaacatgcttgctcct-------------tgataatagcaaaagtcatgatcagtcagatcaaaagaatgtcaattctgaagagcttg |
194 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29336300 |
ttttgtcaaattgaacgtgcttgctccttgatgcatgacgatgataatagcaaaagtcatgatcagtcaaatcaaaagaatgtcaattctgaagagcttg |
29336201 |
T |
 |
| Q |
195 |
caagagatgcaattaatgattctgtgaatcaaaagatatt |
234 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
29336200 |
caagagatgcaattcatgattttgtgaatcaaaagatatt |
29336161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University