View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_552 (Length: 234)
Name: NF10145A_low_552
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_552 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 37 - 214
Target Start/End: Complemental strand, 54428798 - 54428610
Alignment:
| Q |
37 |
catagacttcactctagagttgaaagagtttacttagtacaaaaataactttttatacatccatcattacaatatcnnnnnnngagggaatcactacaat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
54428798 |
catagacttcactctagagttgaaagagtttacttagtacaaaaataacttcttatacatccatcattacaatatctttttttgagggaatcattacaat |
54428699 |
T |
 |
| Q |
137 |
atctaaacacaacttaataccatattgttatgagtgtgga-----------ataaaagtggtgcaaatgatgatgacatggcaaataag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54428698 |
atctaaacacaacttaataccatattgttatgagtgtggaatgcccaattgataaaagtggtgcaaatgatgatgacatggcaaataag |
54428610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University