View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_571 (Length: 231)
Name: NF10145A_low_571
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_571 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 31658681 - 31658583
Alignment:
| Q |
1 |
atcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658681 |
atcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
31658583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Complemental strand, 31658558 - 31658528
Alignment:
| Q |
201 |
taatgggagatttatttgatcgtttaactta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaactta |
31658528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University