View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_575 (Length: 231)
Name: NF10145A_low_575
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_575 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 41103370 - 41103140
Alignment:
| Q |
1 |
gaacaacatcggagaatcgtgtttcgctgatatttgcagagaaagcgcactgatgctgtttgcattcccggaaaacgtggcaagatgcaagaaaactccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41103370 |
gaacaacatcggagaatcgtgtttcgctgatatttgcagagaaagcgcattaatgctgtttgcattcccggaaaacgtggcaaaatgcaagaaaactccg |
41103271 |
T |
 |
| Q |
101 |
gagaaaatgttcagaacgcttgatttatacgaagcgatttcagaaaattggaatcaaattgaatcaattttttcgtcggaatcaaactcaccgatcagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103270 |
gagaaaatgttcagaacgcttgatttatacgaagcgatttcagaaaattggaatcaaattgaatcaattttttcgtcggaatcaaactcaccgatcagat |
41103171 |
T |
 |
| Q |
201 |
cgcaagtcgttgcttcacaggttagactcgg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41103170 |
cgcaagtcgttgcttcacaggttagactcgg |
41103140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 80 - 144
Target Start/End: Complemental strand, 23129108 - 23129044
Alignment:
| Q |
80 |
gcaagatgcaagaaaactccggagaaaatgttcagaacgcttgatttatacgaagcgatttcaga |
144 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
23129108 |
gcaaaatgcaagaaaactcctgagaaaatgttcagaactcttgatttatacgaagcaatttcaga |
23129044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University