View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_580 (Length: 230)
Name: NF10145A_low_580
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_580 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 1531254 - 1531483
Alignment:
| Q |
1 |
gagtggtctcaaaaggtttaaacttatcactggcattatatttatgctcttctatgcactcatcctttttgttgctggggagacaacaaatttctttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531254 |
gagtggtctcaaaaggtttaaacttatcactggcattatatttatgctcttctatgcactcatcctttttgttgctggggagacaacaaatttctttggt |
1531353 |
T |
|
| Q |
101 |
gacaaagtggagaaatatccctttgctatgagttctgtgttagttcttatagttatcaagtgtctcatattagtaatttcagtcgtattagaagacccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531354 |
gacaaagtggagaaatatccctttgctatgagttctgtgttagttcttatagttatcaagtgtctcatattagtaatttcagtcgtattagaagacccac |
1531453 |
T |
|
| Q |
201 |
ctctttgtcttgtgcaaactatggttttga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1531454 |
ctctttgtcttgtgcaaactatggttttga |
1531483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University