View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_588 (Length: 230)
Name: NF10145A_low_588
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_588 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 49863993 - 49863891
Alignment:
| Q |
18 |
ctaaacttaagagtgtaacgtcaaattcaatgtttgaccattttctaagccacgaaaaaagggggcgaaggaggaatccaagtctcattatgcaaaccaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49863993 |
ctaaacttaagagtgtaacgtcaaattcaatgtttgaccattttctaagccacga-aaaagggggcgaaggaggaatccaagtctcattatgcaaaccaa |
49863895 |
T |
 |
| Q |
118 |
ccct |
121 |
Q |
| |
|
|||| |
|
|
| T |
49863894 |
ccct |
49863891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 169 - 230
Target Start/End: Complemental strand, 49863843 - 49863782
Alignment:
| Q |
169 |
gttggcaatgatatttacattgtatagtgtacaaaatctgatcgcatgactcccaaatttga |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49863843 |
gttggcaatgatttttacattgtatagtgtacaaaatctgatcgcatgactcccaaatttga |
49863782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University