View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_596 (Length: 230)

Name: NF10145A_low_596
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_596
NF10145A_low_596
[»] chr8 (21 HSPs)
chr8 (12-228)||(2856581-2856793)
chr8 (12-102)||(24473676-24473767)
chr8 (12-102)||(37396763-37396854)
chr8 (1-72)||(6198701-6198774)
chr8 (12-72)||(15444585-15444646)
chr8 (12-72)||(17431342-17431403)
chr8 (12-72)||(33727043-33727104)
chr8 (11-102)||(16169515-16169607)
chr8 (12-102)||(6199004-6199095)
chr8 (1-70)||(16169216-16169287)
chr8 (24-102)||(33726732-33726811)
chr8 (1-102)||(41662564-41662667)
chr8 (12-72)||(20861576-20861637)
chr8 (12-102)||(9623557-9623648)
chr8 (12-102)||(15444266-15444357)
chr8 (35-102)||(34498463-34498530)
chr8 (12-72)||(34498177-34498237)
chr8 (12-72)||(37397083-37397144)
chr8 (35-102)||(24473422-24473489)
chr8 (12-72)||(25439065-25439125)
chr8 (16-72)||(15442822-15442879)
[»] chr1 (49 HSPs)
chr1 (35-179)||(19007784-19007923)
chr1 (12-129)||(19008631-19008749)
chr1 (12-102)||(9347181-9347272)
chr1 (12-102)||(21687375-21687466)
chr1 (12-102)||(49317806-49317897)
chr1 (12-102)||(999433-999524)
chr1 (1-102)||(42611228-42611331)
chr1 (12-102)||(48104733-48104824)
chr1 (15-72)||(27172480-27172537)
chr1 (12-102)||(4692341-4692432)
chr1 (12-102)||(21687080-21687171)
chr1 (12-102)||(28634065-28634156)
chr1 (1-102)||(42611522-42611625)
chr1 (12-102)||(50429989-50430080)
chr1 (12-102)||(50526380-50526471)
chr1 (12-102)||(50615529-50615620)
chr1 (12-102)||(50623357-50623448)
chr1 (1-72)||(6703503-6703576)
chr1 (12-72)||(20480222-20480283)
chr1 (12-72)||(26814749-26814810)
chr1 (12-72)||(32162981-32163042)
chr1 (12-72)||(48105054-48105115)
chr1 (12-99)||(49318077-49318165)
chr1 (12-102)||(49318353-49318442)
chr1 (12-102)||(6703802-6703893)
chr1 (12-102)||(9347459-9347550)
chr1 (12-70)||(44224059-44224118)
chr1 (12-102)||(46824186-46824277)
chr1 (1-102)||(50429699-50429801)
chr1 (12-69)||(13918501-13918559)
chr1 (12-72)||(26815057-26815118)
chr1 (12-68)||(28633775-28633832)
chr1 (12-68)||(46823898-46823955)
chr1 (1-72)||(20480552-20480623)
chr1 (12-66)||(27172170-27172225)
chr1 (1-72)||(13918805-13918878)
chr1 (12-72)||(20371290-20371351)
chr1 (1-99)||(4692064-4692163)
chr1 (12-102)||(20371093-20371183)
chr1 (34-72)||(32162801-32162839)
chr1 (15-68)||(44911083-44911137)
chr1 (16-72)||(39691938-39691995)
chr1 (1-68)||(44911379-44911448)
chr1 (18-69)||(44223745-44223797)
chr1 (12-102)||(999166-999256)
chr1 (12-69)||(47498354-47498412)
chr1 (48-102)||(50615289-50615343)
chr1 (48-102)||(50623117-50623171)
chr1 (15-68)||(50949507-50949561)
[»] chr2 (24 HSPs)
chr2 (13-115)||(5378717-5378820)
chr2 (13-115)||(5379854-5379957)
chr2 (12-102)||(26692728-26692819)
chr2 (12-102)||(8851203-8851294)
chr2 (12-69)||(16911210-16911268)
chr2 (1-72)||(5793490-5793563)
chr2 (12-72)||(7664611-7664672)
chr2 (12-104)||(17851309-17851401)
chr2 (12-102)||(16910882-16910973)
chr2 (12-72)||(6324972-6325033)
chr2 (12-72)||(7664303-7664364)
chr2 (12-102)||(7979620-7979711)
chr2 (12-94)||(19141765-19141848)
chr2 (12-102)||(26692451-26692542)
chr2 (12-72)||(7979941-7980002)
chr2 (12-72)||(8851521-8851581)
chr2 (1-71)||(6325286-6325358)
chr2 (191-228)||(5378890-5378927)
chr2 (191-228)||(5379744-5379781)
chr2 (12-61)||(37720259-37720307)
chr2 (48-102)||(18750048-18750102)
chr2 (15-68)||(41790548-41790602)
chr2 (15-68)||(41790854-41790908)
chr2 (35-72)||(17851056-17851093)
[»] chr3 (30 HSPs)
chr3 (12-104)||(53687943-53688036)
chr3 (1-102)||(3353460-3353562)
chr3 (1-102)||(27238508-27238611)
chr3 (12-102)||(3353182-3353271)
chr3 (12-72)||(22429213-22429274)
chr3 (12-102)||(22429504-22429595)
chr3 (12-102)||(36180609-36180700)
chr3 (12-72)||(40848575-40848636)
chr3 (12-72)||(42673234-42673295)
chr3 (11-102)||(44008021-44008113)
chr3 (16-102)||(10348538-10348625)
chr3 (1-70)||(44008341-44008412)
chr3 (12-72)||(10348737-10348798)
chr3 (16-72)||(26007557-26007614)
chr3 (12-68)||(27238842-27238899)
chr3 (12-72)||(48159952-48160013)
chr3 (12-102)||(26007236-26007327)
chr3 (12-72)||(24485076-24485137)
chr3 (12-72)||(36180928-36180989)
chr3 (12-72)||(40848899-40848960)
chr3 (12-72)||(42456134-42456194)
chr3 (15-99)||(47666246-47666331)
chr3 (12-72)||(48160271-48160332)
chr3 (12-102)||(42673032-42673123)
chr3 (12-66)||(53688247-53688302)
chr3 (16-72)||(8314072-8314129)
chr3 (12-72)||(24485398-24485459)
chr3 (39-72)||(42455852-42455885)
chr3 (35-102)||(53766499-53766565)
chr3 (1-68)||(47665954-47666023)
[»] chr7 (27 HSPs)
chr7 (12-102)||(37888888-37888979)
chr7 (12-102)||(9034923-9035014)
chr7 (12-102)||(10533089-10533180)
chr7 (12-102)||(17157022-17157113)
chr7 (12-102)||(18864022-18864113)
chr7 (12-102)||(20419232-20419323)
chr7 (12-102)||(37889167-37889258)
chr7 (9-102)||(42418643-42418737)
chr7 (12-102)||(13744141-13744232)
chr7 (12-102)||(37972304-37972395)
chr7 (12-102)||(48359374-48359464)
chr7 (13-102)||(3205001-3205091)
chr7 (1-72)||(18864340-18864413)
chr7 (12-72)||(22740211-22740272)
chr7 (1-100)||(38826823-38826924)
chr7 (12-72)||(42418966-42419027)
chr7 (12-69)||(36527739-36527797)
chr7 (12-72)||(20418943-20419004)
chr7 (15-99)||(29292980-29293065)
chr7 (12-72)||(37972015-37972076)
chr7 (12-102)||(3204722-3204813)
chr7 (12-102)||(13741612-13741702)
chr7 (12-102)||(36527438-36527529)
chr7 (15-99)||(29293257-29293342)
chr7 (12-68)||(48359600-48359657)
chr7 (12-70)||(9035232-9035292)
chr7 (12-102)||(22740500-22740590)
[»] chr5 (24 HSPs)
chr5 (1-102)||(41072122-41072225)
chr5 (12-72)||(22729062-22729122)
chr5 (12-102)||(3888570-3888661)
chr5 (12-102)||(12498836-12498927)
chr5 (12-102)||(19514581-19514672)
chr5 (13-102)||(34147195-34147285)
chr5 (12-72)||(26570784-26570845)
chr5 (12-104)||(26571070-26571163)
chr5 (1-72)||(43464130-43464203)
chr5 (12-72)||(10098879-10098940)
chr5 (1-72)||(25940564-25940637)
chr5 (1-72)||(34147448-34147521)
chr5 (12-71)||(3888294-3888354)
chr5 (12-71)||(22729379-22729439)
chr5 (1-72)||(37780682-37780753)
chr5 (12-68)||(12498622-12498679)
chr5 (12-72)||(21207281-21207342)
chr5 (35-72)||(25940903-25940940)
chr5 (1-72)||(37610557-37610629)
chr5 (16-102)||(2817208-2817294)
chr5 (15-72)||(11316912-11316970)
chr5 (35-68)||(19514905-19514938)
chr5 (12-67)||(25940956-25941013)
chr5 (12-64)||(43463810-43463863)
[»] chr4 (30 HSPs)
chr4 (1-102)||(23540160-23540263)
chr4 (12-102)||(25162221-25162312)
chr4 (12-102)||(28196401-28196492)
chr4 (12-102)||(28196681-28196772)
chr4 (1-102)||(39086531-39086634)
chr4 (13-102)||(32703281-32703371)
chr4 (12-72)||(39912108-39912168)
chr4 (12-102)||(169347-169438)
chr4 (12-102)||(292837-292928)
chr4 (12-102)||(32703558-32703649)
chr4 (12-102)||(39744373-39744464)
chr4 (1-102)||(48406293-48406396)
chr4 (12-72)||(9380679-9380740)
chr4 (16-102)||(169073-169160)
chr4 (12-102)||(4239274-4239365)
chr4 (12-70)||(9380362-9380421)
chr4 (12-102)||(48406016-48406107)
chr4 (12-72)||(293155-293216)
chr4 (12-72)||(9023618-9023679)
chr4 (12-72)||(12757821-12757882)
chr4 (12-72)||(25161933-25161994)
chr4 (16-72)||(39744089-39744146)
chr4 (12-71)||(12758143-12758203)
chr4 (1-71)||(44468862-44468934)
chr4 (12-102)||(9023299-9023390)
chr4 (12-70)||(43292092-43292151)
chr4 (12-66)||(43292302-43292356)
chr4 (15-68)||(26207418-26207472)
chr4 (15-68)||(26207688-26207742)
chr4 (35-96)||(23539918-23539979)
[»] chr6 (14 HSPs)
chr6 (35-102)||(7654456-7654523)
chr6 (12-102)||(33974207-33974298)
chr6 (15-99)||(2354466-2354551)
chr6 (12-69)||(10087799-10087857)
chr6 (12-72)||(13176994-13177055)
chr6 (35-102)||(13176698-13176765)
chr6 (12-102)||(22754998-22755088)
chr6 (12-99)||(29074283-29074371)
chr6 (12-99)||(29079047-29079135)
chr6 (12-99)||(29106856-29106944)
chr6 (35-72)||(22684296-22684333)
chr6 (35-72)||(22754735-22754772)
chr6 (12-68)||(32733612-32733669)
chr6 (12-68)||(32733938-32733995)
[»] scaffold0029 (2 HSPs)
scaffold0029 (12-72)||(9961-10022)
scaffold0029 (36-72)||(10286-10322)
[»] scaffold0017 (2 HSPs)
scaffold0017 (12-72)||(184894-184955)
scaffold0017 (12-102)||(185182-185273)
[»] scaffold0460 (2 HSPs)
scaffold0460 (12-102)||(385-476)
scaffold0460 (16-72)||(703-758)
[»] scaffold0041 (2 HSPs)
scaffold0041 (12-102)||(38306-38397)
scaffold0041 (35-102)||(38603-38670)
[»] scaffold0069 (2 HSPs)
scaffold0069 (12-72)||(50444-50505)
scaffold0069 (12-102)||(50128-50218)
[»] scaffold0176 (1 HSPs)
scaffold0176 (12-72)||(19675-19736)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 2856581 - 2856793
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctgg-catctggcgctgatgtgtctgtttttatgtgcc 109  Q
    ||||||| |||||| ||||||| |||||||||||||||||||||||||||||  ||||| |||| | |||| ||   ||||||||||||||||||| |||    
2856581 atagtttaaaacgttcgattttatcccctatagttttccccctttctgatttattggtcgcccttgacatccgg---tgatgtgtctgtttttatgcgcc 2856677  T
110 acgtgtgtaagtccatttttaaaatnnnnnnnnttgaattttttacatttttagaaaaggaggcacgtgagtgaggcctatgtgaccgttgcaaaaaggg 209  Q
    ||||||  ||||| ||||  ||||           |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2856678 acgtgt--aagtcaatttaaaaaaataaaaaaaaggaattttc-acatttttagaaaaggaggcacgtgagtgaggcctatgtgaccgttgcaaaaaggg 2856774  T
210 ataaaaatctgaaatccct 228  Q
    |||||||||||||||||||    
2856775 ataaaaatctgaaatccct 2856793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 24473767 - 24473676
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
24473767 atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 24473676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 37396763 - 37396854
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
37396763 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 37396854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 6198701 - 6198774
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||| |||||||||||||| |||||||| |||| ||||||||||||| ||||||||||||||||||||    
6198701 attttgcaccctatagttttaaacgagcgattttgccccctatagttttccccatttctgattttatggtcccc 6198774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 15444646 - 15444585
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||    
15444646 atagttttaaacgagcgattttatcccctatagttttccctctttctgattttatggtcccc 15444585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 17431342 - 17431403
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
17431342 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 17431403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 33727104 - 33727043
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
33727104 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 33727043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 11 - 102
Target Start/End: Complemental strand, 16169607 - 16169515
Alignment:
11 tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||| ||| || ||| | | |||||| |||||||||||    
16169607 tatagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggttcccatgacatttagtgctgatatgtctgttttt 16169515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 6199095 - 6199004
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||| || ||| | | |||||  |||||||||||    
6199095 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatgatccccatgacatttagtgctgaaatgtctgttttt 6199004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 16169216 - 16169287
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc 70  Q
    ||||||||||| ||||||||||||| || |||||||||| |||||||||| |||||||||||||||||||||    
16169216 attttgcacctcatagttttaaacgagcaatttttccccctatagttttctccctttctgattttatggtcc 16169287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 33726732 - 33726811
Alignment:
24 gtgcgatttttcc-cctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||| || |||||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
33726732 gtgcgattttgcctcctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 33726811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 41662564 - 41662667
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    ||||||||||| ||||||||||||| |||||||| |||| |||||||||| |||||||| |||||||||| ||| || ||| | | |||||||||| |||    
41662564 attttgcacctcatagttttaaacgagcgattttgccccctatagttttctccctttctaattttatggttcccatgacatttagtgctgatgtgtttgt 41662663  T
99 tttt 102  Q
    ||||    
41662664 tttt 41662667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 20861637 - 20861576
Alignment:
12 atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| || |||||| |||||||||||||||||||||||||||||    
20861637 atagttttaaacgagcgattttgcctcctataattttccccctttctgattttatggtcccc 20861576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9623557 - 9623648
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| || ||||| |||| ||||||||||||  |||||||||||||||||||| || ||| | | |||||| |||||||||||    
9623557 atagttttaaacgagcaattttgccccctatagttttccctttttctgattttatggtccccttgacatttagtgctgatatgtctgttttt 9623648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 15444266 - 15444357
Alignment:
12 atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| | |||||||||||||||||||| ||||||||||||| || || ||| | | |||||| | |||||||||    
15444266 atagttttaaacgagcgattttgctccctatagttttccccctttatgattttatggtctccatgacatttagtgctgatatctctgttttt 15444357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 34498530 - 34498463
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||| ||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
34498530 cccctatatttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 34498463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 34498177 - 34498237
Alignment:
12 atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| | ||||||||||| |||||||||||||||||||||||||    
34498177 atagttttaaacgagcgattttgcaccctatagttt-ccccctttctgattttatggtcccc 34498237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 37397144 - 37397083
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||| ||| |||| ||||| ||||||||||||||||||||||||||||    
37397144 atagttttaaacgagcgactttgccccctatagatttccccctttctgattttatggtcccc 37397083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 24473422 - 24473489
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||| ||||||||||||||||||||||||| || ||| | | | ||| ||||||||||||    
24473422 cccctatagtttcccccctttctgattttatggtccccatgacatttagtgatgacgtgtctgttttt 24473489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 25439125 - 25439065
Alignment:
12 atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||| ||||||||| |||||||| ||||||||||||||||    
25439125 atagttttaaacgagcgattttgccctctatagttt-ccccctttttgattttatggtcccc 25439065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 15442822 - 15442879
Alignment:
16 ttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||||||||||| | ||||||  ||||||| |||| ||||||||||||||||    
15442822 ttttaaacgtgcgattttgcaccctatccttttcccgctttgtgattttatggtcccc 15442879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 49)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 35 - 179
Target Start/End: Original strand, 19007784 - 19007923
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgccacgtgtgtaagtccatttttaaaat 134  Q
    |||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||     
19007784 cccctatagttttccctctttctgatttgatggtcccccttgcatctggcgctgatgtgtctgtttttatgtgccatgtgtgtaagtcaattttaaaaa- 19007882  T
135 nnnnnnnnttgaattttttacatttttagaaaaggaggcacgtga 179  Q
            ||| | |||| ||||||||||||||||||||||||||    
19007883 ----aaaattggaattttcacatttttagaaaaggaggcacgtga 19007923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 12 - 129
Target Start/End: Complemental strand, 19008749 - 19008631
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgcca 110  Q
    ||||||| |||||||| ||||| |||| |||| ||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||    
19008749 atagtttaaaacgtgcaattttgccccctataattttccccctttctgatttgatggtaccccttgcatctggcgctgatgtgtctgtttttatgtgcca 19008650  T
111 cgtgtgtaagtccattttt 129  Q
     ||||||||||| ||||||    
19008649 tgtgtgtaagtcaattttt 19008631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9347181 - 9347272
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| | || ||| | ||||||||||||||||||||    
9347181 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccgcatgacatttagcgctgatgtgtctgttttt 9347272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 21687466 - 21687375
Alignment:
12 atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
21687466 atagttttaaacgagcgatttttccctctgtagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 21687375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 49317806 - 49317897
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
49317806 atagttttaaacgagcgattttaccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 49317897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 999524 - 999433
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||| ||||||||||    
999524 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgcgtctgttttt 999433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 42611228 - 42611331
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    ||||||||||| ||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| ||| || ||| | | | ||||||||||||    
42611228 attttgcacctcatagttttaaacgagcgattttgcctcctatagttttccccctttctgattttatggttcccatgacatttagtgttgatgtgtctgt 42611327  T
99 tttt 102  Q
    ||||    
42611328 tttt 42611331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 48104733 - 48104824
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
48104733 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 48104824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 27172537 - 27172480
Alignment:
15 gttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
27172537 gttttaaacgagcgattttgcccctatagttttccccctttctgattttatggtcccc 27172480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 4692432 - 4692341
Alignment:
12 atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| || ||||||||||| |||||||||||||||||||||||| || ||| | | |||||||||||| |||||    
4692432 atagttttaaacgagcgattttacctcctatagtttttcccctttctgattttatggtccccatgacatttagtgctgatgtgtctattttt 4692341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 21687080 - 21687171
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||||||||| || ||| | | |||||| |||||||||||    
21687080 atagttttaaacgagcgattttgccccctatagttttcctcctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 21687171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 28634156 - 28634065
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||  ||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
28634156 atagttttaaacgatcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 28634065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 42611625 - 42611522
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    ||||||||||| ||||||||||||  |||||||| |||| ||||||||| |||||||||||||||||||||||| |  ||| | | ||||||||||||||    
42611625 attttgcacctcatagttttaaacaagcgattttgccccctatagtttttcccctttctgattttatggtccccataacatttagtgctgatgtgtctgt 42611526  T
99 tttt 102  Q
    ||||    
42611525 tttt 42611522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50430080 - 50429989
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
50430080 atagttttaaacgagcgattttgccccctatagttttctccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 50429989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50526471 - 50526380
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| | || ||| |   ||||||||||||||||||    
50526471 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccacatgacatttaatgctgatgtgtctgttttt 50526380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50615620 - 50615529
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||| ||||||||||    
50615620 atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgcgtctgttttt 50615529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50623448 - 50623357
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||| ||||||||||    
50623448 atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgcgtctgttttt 50623357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 6703503 - 6703576
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| ||||||||||||| |||||||| |||| ||||||||||||| ||||||||||||||||||||    
6703503 attttgcacctcatagttttaaacgagcgattttgccccctatagttttccccttttctgattttatggtcccc 6703576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 20480222 - 20480283
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
20480222 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 20480283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 26814749 - 26814810
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
26814749 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 26814810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 32163042 - 32162981
Alignment:
12 atagttttaaacgtgcgatttttcccct-atagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||    
32163042 atagttttaaacgagcgattttgccccttatagttttccccctttctgattttatggtcccc 32162981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 48105115 - 48105054
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
48105115 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 48105054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 49318165 - 49318077
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    ||||||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||||||||||||    
49318165 atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgtt 49318077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 49318442 - 49318353
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||||||||||||||||  |||||||||||||||| ||| || ||| | | ||||||||||||||||||    
49318442 atagttttaaacgagcgattttatcccctatagttttccc--tttctgattttatggttcccatgacatttagtgctgatgtgtctgttttt 49318353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 6703893 - 6703802
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| || | |||||||||||||||||||||||||||||||| | || ||| | | |||||| |||||||||||    
6703893 atagttttaaacgagcgattttgcctcatatagttttccccctttctgattttatggtcctcatgacatttagtgctgatatgtctgttttt 6703802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 9347550 - 9347459
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | | |||||||||| |||||    
9347550 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgttgatgtgtctattttt 9347459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 44224118 - 44224059
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcc 70  Q
    ||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||    
44224118 atagttttaaacgagcgattttgtcccctatagttttacccctttctgattttatggtcc 44224059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 46824277 - 46824186
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||| |||||||||||||||| || ||| | | |||||  |||||||||||    
46824277 atagttttaaacgagcgattttgccccctatagttttccccctttttgattttatggtccccatgacatttagtgctgaaatgtctgttttt 46824186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 50429699 - 50429801
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    ||||||||||| ||||||||||||| |||||||| |||| ||||||||||  |||||||||||||||||| ||| || ||| | | ||||||||||||||    
50429699 attttgcacctcatagttttaaacgagcgattttgccccctatagttttcatcctttctgattttatggt-cccatgacatttagtgctgatgtgtctgt 50429797  T
99 tttt 102  Q
    ||||    
50429798 tttt 50429801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 13918501 - 13918559
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc 69  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||    
13918501 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtc 13918559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 26815118 - 26815057
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| |||| |||||||||||||||||||||||||||||    
26815118 atagttttaaacgagcgattttgccccctataattttccccctttctgattttatggtcccc 26815057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 28633775 - 28633832
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||    
28633775 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt 28633832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 46823898 - 46823955
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||    
46823898 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt 46823955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 20480623 - 20480552
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||| |||||||||||||| |||||||  |||||||||| || ||||||||||||||||||||||||    
20480623 attttgcaccctatagttttaaacgagcgatttc-cccctatagtgtttcccctttctgattttatggtcccc 20480552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 27172170 - 27172225
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatg 66  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||    
27172170 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatg 27172225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 13918878 - 13918805
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| |||||||||||||  ||||||| |||| |||||||||||||| || ||||||||||||||||    
13918878 attttgcacctcatagttttaaacgaacgattttgccccctatagttttccccccttttgattttatggtcccc 13918805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 20371351 - 20371290
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| || ||||| |||| |||||||| |||||||||||||||||||||||||    
20371351 atagttttaaacgagcaattttgccccctatagtttaccccctttctgattttatggtcccc 20371290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 4692064 - 4692163
Alignment:
1 attttgca-cctatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    |||||||| |||||||||| ||||| || ||||| |||| |||||||| ||||||||||||||||||||| ||| || ||| | | ||||||||||||||    
4692064 attttgcatcctatagtttaaaacgagccattttgccccctatagttt-ccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgt 4692162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 20371093 - 20371183
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| | ||||||||||| |||||||||||||||||||  || ||| | | |||||| |||||||||||    
20371093 atagttttaaacgagcgattttgccccctgtagttttcccc-tttctgattttatggtccctatgacatttagtgctgatatgtctgttttt 20371183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 72
Target Start/End: Original strand, 32162801 - 32162839
Alignment:
34 tcccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||||||| ||||||||||||||||||||||||    
32162801 tcccctatagtttttcccctttctgattttatggtcccc 32162839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 44911083 - 44911137
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||| ||||| |||||||| |||| ||||||||||||||||||||||||||||||    
44911083 gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggt 44911137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 39691995 - 39691938
Alignment:
16 ttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| |||||| | ||||||  |||||||||||||||||||||||||||||    
39691995 ttttaaacgtgtgattttgcaccctatctttttccccctttctgattttatggtcccc 39691938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 44911448 - 44911379
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||||||||| ||| |||| ||||| |||||||| |||| ||||||||||| ||||||||||||||||||    
44911448 attttgcaccctattgtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt 44911379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 44223745 - 44223797
Alignment:
18 ttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc 69  Q
    ||||||| |||||||| |||| ||||||||| |||||||||||||||||||||    
44223745 ttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtc 44223797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 999166 - 999256
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| ||||||||  ||||||||||||| | ||||||||||||||||||| || || ||| | | | | ||||||||||||||    
999166 atagttttaaacgagcgattttgccccctatagtttt-ctcctttctgattttatggtctccatgacatttagtgttaatgtgtctgttttt 999256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 47498354 - 47498412
Alignment:
12 atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtc 69  Q
    ||||||||||||  |||||||| ||| ||||||||||| |||||| |||||||||||||    
47498354 atagttttaaacaagcgattttgccctctatagttttctccctttttgattttatggtc 47498412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 50615289 - 50615343
Alignment:
48 ccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||||||||||||||| || ||| |   ||||||||||||||||||    
50615289 ccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt 50615343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 50623117 - 50623171
Alignment:
48 ccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||||||||||||||| || ||| |   ||||||||||||||||||    
50623117 ccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt 50623171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 50949561 - 50949507
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||| ||||| |||||||| |||| ||||||||| ||||||||||||||||||||    
50949561 gtttaaaacgagcgattttgccccctatagtttttcccctttctgattttatggt 50949507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 24)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 115
Target Start/End: Original strand, 5378717 - 5378820
Alignment:
13 tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgccac 111  Q
    |||||| |||||||||||||| |||| |||| ||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||    
5378717 tagtttaaaacgtgcgattttgccccctatattttaccctctttctgatttgatggtccccctggcatctggcgctgatgtgtctgttttaatgtgccac 5378816  T
112 gtgt 115  Q
    ||||    
5378817 gtgt 5378820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 115
Target Start/End: Complemental strand, 5379957 - 5379854
Alignment:
13 tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgccac 111  Q
    |||||| |||||||||||||| |||| |||| ||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||    
5379957 tagtttaaaacgtgcgattttgccccctatattttaccccctttctgatttgatggtccccctgacatctggcgctgatgtgtctgttttaatgtgccac 5379858  T
112 gtgt 115  Q
    ||||    
5379857 gtgt 5379854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 26692819 - 26692728
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
26692819 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 26692728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 8851203 - 8851294
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | | |||| |||||||||||    
8851203 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt 8851294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 16911268 - 16911210
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtc 69  Q
    ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
16911268 atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtc 16911210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 5793490 - 5793563
Alignment:
1 attttgca-cctatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    |||||||| |||||||||||||||| |||||||| |||| |||||||||||| |||||||||||||||||||||    
5793490 attttgcatcctatagttttaaacgagcgattttgccccctatagttttccctctttctgattttatggtcccc 5793563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 7664672 - 7664611
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
7664672 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 7664611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 17851401 - 17851309
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttat 104  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||| |||||||||||||    
17851401 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt-cccatgacatttagtgctgatatgtctgtttttat 17851309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 16910882 - 16910973
Alignment:
12 atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||||||||||||||||| || ||| | | | |||| |||||||||||    
16910882 atagttttaaacgagcgattttgccctctatagttttcctcctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt 16910973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 6324972 - 6325033
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||||    
6324972 atagttttaaacgagcgattttgtcccctatagttttccctctttctgattttatggccccc 6325033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 7664303 - 7664364
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| |||| |||||||||||||||||||||||||||||    
7664303 atagttttaaacgagcgattttgccccctataattttccccctttctgattttatggtcccc 7664364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 7979620 - 7979711
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||| ||||||||||||||| ||||  || ||| | | |||||| |||||||||||    
7979620 atagttttaaacgagcgattttgccccctatagttttccctctttctgattttatgatccctatgacatttagtgctgatatgtctgttttt 7979711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 19141848 - 19141765
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgt 94  Q
    ||||||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | ||||||||||    
19141848 atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgt 19141765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 26692451 - 26692542
Alignment:
12 atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| | ||||||| |||| ||||||||||||||||||||||||  | ||| |   ||||||||||||||||||    
26692451 atagttttaaacgagcgattttgctccctataatttttcccctttctgattttatggtccccaagacatttattgctgatgtgtctgttttt 26692542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 7980002 - 7979941
Alignment:
12 atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||  || ||||||||||| ||||||||||||||||||||||||    
7980002 atagttttaaacgagcgatttcgccgcctatagtttttcccctttctgattttatggtcccc 7979941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 8851581 - 8851521
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||| ||||||||||||||||||||    
8851581 atagttttaaacgagcgattttgccccctatagttttcccc-tttctgattttatggtcccc 8851521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 6325358 - 6325286
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc 71  Q
    ||||||||||| ||||| ||||||| |||||||| |||| ||||||||||||| ||||||| |||||||||||    
6325358 attttgcacctcatagtattaaacgagcgattttgccccctatagttttccccatttctgactttatggtccc 6325286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 5378890 - 5378927
Alignment:
191 gtgaccgttgcaaaaagggataaaaatctgaaatccct 228  Q
    ||||||||||||||||||||||||||||| ||||||||    
5378890 gtgaccgttgcaaaaagggataaaaatctaaaatccct 5378927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 228
Target Start/End: Complemental strand, 5379781 - 5379744
Alignment:
191 gtgaccgttgcaaaaagggataaaaatctgaaatccct 228  Q
    ||||||||||||||||||||||||||||| ||||||||    
5379781 gtgaccgttgcaaaaagggataaaaatctaaaatccct 5379744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 37720259 - 37720307
Alignment:
12 atagttttaaacgtgcgatttttcccctatagttttccccctttctgatt 61  Q
    ||||||||||||| |||||||| ||||||||||||| |||||||||||||    
37720259 atagttttaaacgagcgattttgcccctatagtttt-cccctttctgatt 37720307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Complemental strand, 18750102 - 18750048
Alignment:
48 ccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||||||||||||||| || ||| | | |||||||||| |||||||    
18750102 ccccctttctgattttatggtccccatgacatttagtgctgatgtgtttgttttt 18750048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 41790548 - 41790602
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||| ||||| |||||||| |||| ||||||||||| ||||||||||||||||||    
41790548 gtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt 41790602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 41790908 - 41790854
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||| ||||| |||||||| |||| |||||||||||| |||||||||||||||||    
41790908 gtttaaaacgagcgattttgccccctatagttttccctctttctgattttatggt 41790854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 72
Target Start/End: Original strand, 17851056 - 17851093
Alignment:
35 cccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||| ||||||||||| ||||||||||||||||    
17851056 cccctatagatttccccctttatgattttatggtcccc 17851093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 30)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 53687943 - 53688036
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttat 104  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | ||| ||||||||||||||||||    
53687943 atagttttaaacgagcgattttaccccctatagttttccccctttctgattttatggtccccatgacatttagcgttgatgtgtctgtttttat 53688036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 3353562 - 3353460
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    ||||||||||| ||||||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||| || ||| | | ||||||||||||||    
3353562 attttgcacctcatagttttaaacgagcgattttgccccctatagttt-ccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgt 3353464  T
99 tttt 102  Q
    ||||    
3353463 tttt 3353460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 27238508 - 27238611
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    |||||||||| |||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || | | | | |||||| |||||||    
27238508 attttgcaccctatagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacttttagtgctgatatgtctgt 27238607  T
99 tttt 102  Q
    ||||    
27238608 tttt 27238611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 3353182 - 3353271
Alignment:
12 atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||  |||||||||||||||||||||||||||||||||||||| || ||| | |  |||||||||||||||||    
3353182 atagttttaaacgagcgatttc-cccctatagttttccccctttctgattttatggtccccatgacatttagtactgatgtgtctgttttt 3353271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 22429213 - 22429274
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||    
22429213 atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtcccc 22429274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 22429595 - 22429504
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
22429595 atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 22429504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 36180609 - 36180700
Alignment:
12 atagttttaaacgtgcgattttt-cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| ||||||||  |||||||||||||||||||||||||||||||||||||| || ||| | | | |||| |||||||||||    
36180609 atagttttaaacgagcgattttgacccctatagttttccccctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt 36180700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 40848575 - 40848636
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
40848575 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 40848636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 42673295 - 42673234
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
42673295 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 42673234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 11 - 102
Target Start/End: Original strand, 44008021 - 44008113
Alignment:
11 tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||| ||| || ||| | | |||||| |||||||||||    
44008021 tatagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggttcccatgacatttagtgctgatatgtctgttttt 44008113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 10348538 - 10348625
Alignment:
16 ttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||| |||||||| |||||||||||||| ||||||||||||||||| |||||| || ||| | | |||||| |||||||||||    
10348538 ttttaaacgagcgattttgtcccctatagtttttcccctttctgattttatagtccccatgacatttagtgctgatatgtctgttttt 10348625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 44008412 - 44008341
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc 70  Q
    ||||||||||| ||||||||||||| || |||||||||| |||||||||| |||||||||||||||||||||    
44008412 attttgcacctcatagttttaaacgagcaatttttccccctatagttttctccctttctgattttatggtcc 44008341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 10348798 - 10348737
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||| ||||||||||||||    
10348798 atagttttaaacgagcgattttgccccctatagttttccccctttctaattttatggtcccc 10348737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 26007614 - 26007557
Alignment:
16 ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
26007614 ttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 26007557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 27238899 - 27238842
Alignment:
12 atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggt 68  Q
    ||||||||||||| |||||||| | |||||||||||||||||||||||||||||||||    
27238899 atagttttaaacgagcgattttgctccctatagttttccccctttctgattttatggt 27238842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 48159952 - 48160013
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| |||||    
48159952 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatgatcccc 48160013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 26007236 - 26007327
Alignment:
12 atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| ||| ||||||||||||  ||||||||||||||||||||| || ||| | | |||||| | |||||||||    
26007236 atagttttaaacgagcgattttgccctctatagttttccatctttctgattttatggtccccatgacatttagtgctgatatatctgttttt 26007327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 24485076 - 24485137
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||  |||| ||||||||| ||||||||||||||||||||||||    
24485076 atagttttaaacgagcgatttcgccccctatagtttttcccctttctgattttatggtcccc 24485137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 36180989 - 36180928
Alignment:
12 atagttttaaacgtgcgattttt-cccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||| |||||    
36180989 atagttttaaacgagcgattttttcccctatagtttttcccttttctgattttatgatcccc 36180928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 40848960 - 40848899
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||  |||||||| |||| |||||||||| |||||||||||||||||||||||    
40848960 atagttttaaacaagcgattttgccccctatagttttcaccctttctgattttatggtcccc 40848899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 42456194 - 42456134
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| |||||||| |||||||||||||||||||||||||    
42456194 atagttttaaacgagcgattttgccccctatagttt-ccccctttctgattttatggtcccc 42456134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 47666331 - 47666246
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    |||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||||||| ||||    
47666331 gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtgtgtt 47666246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 48160332 - 48160271
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||| |||||    
48160332 atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatgatcccc 48160271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 42673032 - 42673123
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||  ||||||| |||| ||||||||||||||||| ||||||||||| |||| || ||| | | |||||| |||| ||||||    
42673032 atagttttaaacgatcgattttgccccctatagttttccccctttatgattttatggcccccatgacatttagtgctgatatgtccgttttt 42673123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 53688302 - 53688247
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatg 66  Q
    ||||||| ||||| |||||||| |||| ||||||||||||||||||||||||||||    
53688302 atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatg 53688247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 8314072 - 8314129
Alignment:
16 ttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||||||||||| | ||||||  |||||||||||||||||||||||| ||||    
8314072 ttttaaacgtgcgattttgcaccctatcattttccccctttctgattttatggccccc 8314129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 24485459 - 24485398
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| | |||||||| |||| |||||| |||||||||||| ||||||||||||||    
24485459 atagttttaaatgagcgattttgccccctatagtattccccctttctaattttatggtcccc 24485398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 72
Target Start/End: Original strand, 42455852 - 42455885
Alignment:
39 tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||||||||||||||||||||||||    
42455852 tatagttttccccctttctgattttatggtcccc 42455885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 53766565 - 53766499
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||| |||||||| |||||||||||||||||||| || ||| | | |||||| |||||||||||    
53766565 cccctatatttttcccc-tttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 53766499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 47665954 - 47666023
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggt 68  Q
    ||||||||||| || |||| ||||| | |||||| || ||||||||||||||||||| ||||||||||||    
47665954 attttgcacctcattgtttaaaacgagtgattttaccacctatagttttccccctttttgattttatggt 47666023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 27)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 37888888 - 37888979
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
37888888 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 37888979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9034923 - 9035014
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| |   ||||||||||||||||||    
9034923 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt 9035014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 10533089 - 10533180
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||| |||||||    
10533089 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtttgttttt 10533180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 17157022 - 17157113
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
17157022 atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 17157113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 18864022 - 18864113
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
18864022 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 18864113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 20419323 - 20419232
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
20419323 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccgtgacatttagtgctgatatgtctgttttt 20419232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 37889258 - 37889167
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
37889258 atagttttaaacgagcgattttgccccctatagttttctccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 37889167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 9 - 102
Target Start/End: Original strand, 42418643 - 42418737
Alignment:
9 cctatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||||| |||||||| |||| ||||||||||||||||||| |||||||||||||| || ||| | | |||||| |||||||||||    
42418643 cctatagttttaaacgagcgattttgccccctatagttttccccctttctaattttatggtccccatgacatttagtgctgatatgtctgttttt 42418737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 13744232 - 13744141
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||| |||||||||||||||| ||  || | | ||||||||||||||||||    
13744232 atagttttaaacgagcgattttgccccctatagttttccccctttttgattttatggtccccatgatatttagtgctgatgtgtctgttttt 13744141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 37972395 - 37972304
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||| ||||||||||||||| || ||| | | |||||| |||||||||||    
37972395 atagttttaaacgagcgattttgccccctatagttttccccctttcagattttatggtccccatgacatttagtgctgatatgtctgttttt 37972304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 48359374 - 48359464
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
48359374 atagttttaaacgagcgattttaccccctatagttt-ccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 48359464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 102
Target Start/End: Complemental strand, 3205091 - 3205001
Alignment:
13 tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | | |||||| |||||||||    
3205091 tagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgttgatgtatctgttttt 3205001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 18864413 - 18864340
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| ||||||||||| | |||||||| |||| ||||||||||||||||||||||||||||||||||    
18864413 attttgcacctcatagttttaaaagagcgattttgccccctatagttttccccctttctgattttatggtcccc 18864340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 22740211 - 22740272
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
22740211 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 22740272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 38826924 - 38826823
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    ||||||||||| |||||||||||||  || |||| |||| |||||||||||||||||||||||||||| ||||| || ||| | | ||||||||||||||    
38826924 attttgcacctcatagttttaaacgaacggttttgccccctatagttttccccctttctgattttatgatccccatgacatttagtgctgatgtgtctgt 38826825  T
99 tt 100  Q
    ||    
38826824 tt 38826823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 42419027 - 42418966
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
42419027 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 42418966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 36527797 - 36527739
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc 69  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||    
36527797 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtc 36527739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 20418943 - 20419004
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| |||||||||| |||||||||||||||||||||||    
20418943 atagttttaaacgagcgattttgccccctatagttttcaccctttctgattttatggtcccc 20419004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 29292980 - 29293065
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    |||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||||||||||||    
29292980 gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgtt 29293065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 37972015 - 37972076
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||| ||||||||||||||||||||||||    
37972015 atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtcccc 37972076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 3204722 - 3204813
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| || ||||| |||| |||||||||||| ||||||||||||||||||||| || ||| |   |||||||||||| |||||    
3204722 atagttttaaacgagcaattttgccccctatagttttccctctttctgattttatggtccccatgacatttattgctgatgtgtctattttt 3204813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 13741612 - 13741702
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||| |||||||| |||||||||||| || ||| | | |||||| |||||||||||    
13741612 atagttttaaacgagcgattttgccccctatagttttcccactttctga-tttatggtccccgtgacatttagtgctgatctgtctgttttt 13741702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 36527438 - 36527529
Alignment:
12 atagttttaaacgtgcgatttttcccct-atagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||  | ||||||||||| |||||||| ||||||||||||||||| |||||| || ||| ||| | |||||||||| |||||    
36527438 atagttttaaacgatcaatttttccccttatagtttttcccctttctgattttatagtccccatgacatttggtgatgatgtgtctattttt 36527529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 29293342 - 29293257
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    |||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| |   |||||||||||||||    
29293342 gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttactgctgatgtgtctgtt 29293257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 48359657 - 48359600
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    ||||||| ||||| |||||||| |||| ||||||||||||||||||||||||||||||    
48359657 atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggt 48359600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 9035292 - 9035232
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttc-cccctttctgattttatggtcc 70  Q
    ||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||    
9035292 atagttttaaacgagcgattttgccccctatagttttctcccctttctgattttatggtcc 9035232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 22740590 - 22740500
Alignment:
12 atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| | |||||||||||||||| ||| ||||| |||||||||| || ||| | | |||||| |||||||||||    
22740590 atagttttaaacgagcgattttgctccctatagttttcccc-tttatgattctatggtccccatgacatttagtgctgatatgtctgttttt 22740500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 24)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 41072225 - 41072122
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    |||||||||| |||||||||||||| |||||||| |||| ||||||||||||||||||| |||||||||||||| || ||| | | ||||||||||||||    
41072225 attttgcaccctatagttttaaacgagcgattttgccccctatagttttccccctttctaattttatggtccccatgacatttagtgctgatgtgtctgt 41072126  T
99 tttt 102  Q
    ||||    
41072125 tttt 41072122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 22729062 - 22729122
Alignment:
12 atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
22729062 atagttttaaacgagcgattttgcccctatagttttccccctttctgattttatggtcccc 22729122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 3888661 - 3888570
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| |   ||||||||||||||||||    
3888661 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt 3888570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 12498927 - 12498836
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||  |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
12498927 atagttttaaacaagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 12498836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 19514581 - 19514672
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
19514581 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 19514672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 34147195 - 34147285
Alignment:
13 tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||| |||||||||    
34147195 tagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccgtgacatttagtgctgatgtatctgttttt 34147285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 26570784 - 26570845
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||    
26570784 atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtcccc 26570845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 26571163 - 26571070
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttat 104  Q
    ||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||||||||| || ||| | | |||||| |||||||||||||    
26571163 atagttttaaacgagcgattttgccccctatagttttcctcctttctgattttatggtccccatgacatttagtgctgatatgtctgtttttat 26571070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 43464203 - 43464130
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
43464203 attttgcacctcatagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 43464130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 10098940 - 10098879
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||    
10098940 atagttttaaacgagcgattttatcccctatagttttccctctttctgattttatggtcccc 10098879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 25940564 - 25940637
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||| |||||||||||||| |||||||| |||| |||||||||| |||||||||||||||||||||||    
25940564 attttgcaccctatagttttaaacgagcgattttgccccctatagttttcaccctttctgattttatggtcccc 25940637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 34147521 - 34147448
Alignment:
1 attttgcaccta-tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||||  |||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
34147521 attttgcacctcgtagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 34147448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 71
Target Start/End: Original strand, 3888294 - 3888354
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc 71  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||    
3888294 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccc 3888354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 22729439 - 22729379
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc 71  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||    
22729439 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccc 22729379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 37780753 - 37780682
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| || |||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||    
37780753 attttgcacctcattgttttaaacgagcgattttgcccctatagttt-ccccctttctgattttatggtcccc 37780682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 12498622 - 12498679
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||    
12498622 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt 12498679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 21207281 - 21207342
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| |||||||||| |||||||||||||||||||||||    
21207281 atagttttaaacgagcgattttgccccctatagttttcaccctttctgattttatggtcccc 21207342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 72
Target Start/End: Complemental strand, 25940940 - 25940903
Alignment:
35 cccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||||||||||||||||||||||||||||    
25940940 cccctatagttttccccctttctgattttatggtcccc 25940903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 37610629 - 37610557
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| || |||||||||| |||||||| |||| |||||||| |||||||||||||||||||||||||    
37610629 attttgcacctcattgttttaaacgagcgattttgccccctatagttt-ccccctttctgattttatggtcccc 37610557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 2817208 - 2817294
Alignment:
16 ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||| |||||||| |||| |||| |||||||| |||||||||||||||||||| || ||| | | | ||||||||||||||||    
2817208 ttttaaacgagcgattttgccccctatatttttcccc-tttctgattttatggtccccatgacatttagtgttgatgtgtctgttttt 2817294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 11316970 - 11316912
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    |||||||| | |||||||| |||| |||||||||||| |||||||||||||||||||||    
11316970 gttttaaatgagcgattttgccccctatagttttccctctttctgattttatggtcccc 11316912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 68
Target Start/End: Complemental strand, 19514938 - 19514905
Alignment:
35 cccctatagttttccccctttctgattttatggt 68  Q
    ||||||||||||||||||||||||||||||||||    
19514938 cccctatagttttccccctttctgattttatggt 19514905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 25941013 - 25940956
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccc-tttctgattttatgg 67  Q
    ||||||||||||| |||||||| |||| |||||||||||||| |||||||||||||||    
25941013 atagttttaaacgagcgattttgccccctatagttttcccccctttctgattttatgg 25940956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 64
Target Start/End: Original strand, 43463810 - 43463863
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgatttta 64  Q
    ||||||||||||| |||||||| |||| |||||||||| |||||||||||||||    
43463810 atagttttaaacgagcgattttgccccctatagttttctccctttctgatttta 43463863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 30)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 23540263 - 23540160
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    |||||||||| |||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||| |||    
23540263 attttgcaccctatagttttaaacgagcgattttaccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtgtgt 23540164  T
99 tttt 102  Q
    ||||    
23540163 tttt 23540160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 25162312 - 25162221
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
25162312 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 25162221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 28196401 - 28196492
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| |   ||||||||||||||||||    
28196401 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt 28196492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 28196772 - 28196681
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | | ||||||||||||||||    
28196772 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgatgatgtgtctgttttt 28196681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 39086634 - 39086531
Alignment:
1 attttgcaccta-tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    |||||||||||| |||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||  | || ||| | | ||||||||||||||    
39086634 attttgcacctaatagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtctgcatgacatttagtgctgatgtgtctgt 39086535  T
99 tttt 102  Q
    ||||    
39086534 tttt 39086531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 32703281 - 32703371
Alignment:
13 tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| |   ||||||||||||||||||    
32703281 tagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccgtgacatttaatgctgatgtgtctgttttt 32703371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 39912108 - 39912168
Alignment:
12 atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||||||  ||||||| ||||||||||||||||||||||||||||||||||||||    
39912108 atagttttaaacgaacgattttgcccctatagttttccccctttctgattttatggtcccc 39912168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 169438 - 169347
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||| |||||||||||||||| || ||| | | | ||||||||||||||||    
169438 atagttttaaacgagcgattttgccccctatagttttccccctttttgattttatggtccccatgacatttagtgttgatgtgtctgttttt 169347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 292837 - 292928
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| || ||||||||||||||||||||||||||||||| || ||| | | |||||| |||||||||||    
292837 atagttttaaacgagcgattttgccccctacagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 292928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 32703649 - 32703558
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| || ||| | | | ||||||||||||||||    
32703649 atagttttaaacgagcgattttgccccctatagttttccccttttctgattttatggtccccatgacatttagtgatgatgtgtctgttttt 32703558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 39744464 - 39744373
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||| |||||||| || ||| | | |||||| |||||||||||    
39744464 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttgtggtccccatgacatttagtgctgatatgtctgttttt 39744373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 48406396 - 48406293
Alignment:
1 attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt 98  Q
    |||||||||| |||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| || ||| |   ||| ||||||||||    
48406396 attttgcaccctatagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtccccatgacatttaatgcttatgtgtctgt 48406297  T
99 tttt 102  Q
    ||||    
48406296 tttt 48406293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 9380740 - 9380679
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
9380740 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 9380679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 169073 - 169160
Alignment:
16 ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| || ||| | | | ||||||||||||||||    
169073 ttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtccccatgacatttagtgttgatgtgtctgttttt 169160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 4239365 - 4239274
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| | | | |||| |||||||||||    
4239365 atagttttaaacgagcgattttgccccctatatttttccccctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt 4239274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 9380362 - 9380421
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc 70  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||    
9380362 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcc 9380421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 48406016 - 48406107
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||| |||||||||||||||| |||||||||||| || ||| | | | ||||||||||||||||    
48406016 atagttttaaacgagcgattttgccccctataattttccccctttctgactttatggtccccatgacatttagtgatgatgtgtctgttttt 48406107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 293216 - 293155
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||| ||||    
293216 atagttttaaacgagcgattttgccccgtatagttttccccctttctgattttatggccccc 293155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 9023679 - 9023618
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||| | |||||||| |||| ||||||||||||||||||||||||||||||||||    
9023679 atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtcccc 9023618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 12757821 - 12757882
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||||||||||||| || |||||||||||||||||||||    
12757821 atagttttaaacgagcgattttgtcccctatagtttttcctctttctgattttatggtcccc 12757882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 25161933 - 25161994
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||| ||||||||||    
25161933 atagttttaaacgagcgattttgccccctatagttttccccctttctgattgtatggtcccc 25161994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 39744089 - 39744146
Alignment:
16 ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
39744089 ttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 39744146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 12758203 - 12758143
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc 71  Q
    ||||||||||||| || ||||| |||| |||||||||||||||||||||||||||||||||    
12758203 atagttttaaacgagcaattttgccccctatagttttccccctttctgattttatggtccc 12758143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 44468934 - 44468862
Alignment:
1 attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc 71  Q
    ||||||||||| ||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||| ||||    
44468934 attttgcacctcatagttttaaacgagcgattttgccccctatagttttcctcctttctgattttatgatccc 44468862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9023299 - 9023390
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| | |||||| |||| ||||||||||||||||| |||||||||||||||| || ||| |   |||||| |||||||||||    
9023299 atagttttaaacgagtgattttgccccctatagttttccccctttatgattttatggtccccatgacatttaatgctgatatgtctgttttt 9023390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 43292092 - 43292151
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc 70  Q
    ||||||||||||| |||||||| |||| ||||||||| ||||||||||||||||||||||    
43292092 atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtcc 43292151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 43292356 - 43292302
Alignment:
12 atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatg 66  Q
    ||||||||||||| ||||||||  ||||||||||||| ||||||||||||||||||    
43292356 atagttttaaacgagcgattttgccccctatagtttt-cccctttctgattttatg 43292302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 26207418 - 26207472
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||| ||||| |||||||| |||| ||||||||||| ||||||||||||||||||    
26207418 gtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt 26207472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 26207742 - 26207688
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    |||| ||||| |||||||| |||| ||||||||||| ||||||||||||||||||    
26207742 gtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt 26207688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 96
Target Start/End: Original strand, 23539918 - 23539979
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtct 96  Q
    |||||||| |||||| |||||||||||||||||| ||| || ||| | | ||||||||||||    
23539918 cccctatatttttcctcctttctgattttatggttcccatgacatttagtgctgatgtgtct 23539979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 7654523 - 7654456
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||||    
7654523 cccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt 7654456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 33974298 - 33974207
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| || || ||| | | |||||| |||||||||||    
33974298 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtctccatgacatttagtgctgatatgtctgttttt 33974207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 2354466 - 2354551
Alignment:
15 gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    |||| ||||| ||||||||||||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||||||||||||    
2354466 gtttaaaacgagcgatttttccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgtt 2354551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 10087857 - 10087799
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc 69  Q
    ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||    
10087857 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtc 10087799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 13177055 - 13176994
Alignment:
12 atagttttaaacgtgcgatttttcccct-atagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| ||||| |||||| ||||||||||||||||||||||||||    
13177055 atagttttaaacgagcgattttgccccttatagttgtccccctttctgattttatggtcccc 13176994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 13176698 - 13176765
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    |||||||||||||||| ||||||||||||||||||||| || ||| | | |||||| |||||||||||    
13176698 cccctatagttttcccactttctgattttatggtccccgtgacatttagtgctgatatgtctgttttt 13176765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 22755088 - 22754998
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||| ||||||||||||| |||||| || ||| | | |||||| |||||||||||    
22755088 atagttttaaacgagcgattttgccccctatagttttcccc-tttctgattttattgtccccatgacatttagtgctgatatgtctgttttt 22754998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 29074371 - 29074283
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    ||||||| ||||| |||||||| |||| |||||||||| ||||||||||||||||| | ||| || ||| | | |||||||||||||||    
29074371 atagtttaaaacgagcgattttcccccctatagttttcgccctttctgattttatgattcccatgacatttagtgctgatgtgtctgtt 29074283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 29079135 - 29079047
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    ||||||| ||||| |||||||| |||| |||||||||| ||||||||||||||||| | ||| || ||| | | |||||||||||||||    
29079135 atagtttaaaacgagcgattttcccccctatagttttcgccctttctgattttatgattcccatgacatttagtgctgatgtgtctgtt 29079047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 29106944 - 29106856
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt 99  Q
    ||||||| ||||| |||||||| |||| |||||||||| ||||||||||||||||| | ||| || ||| | | |||||||||||||||    
29106944 atagtttaaaacgagcgattttcccccctatagttttcgccctttctgattttatgattcccatgacatttagtgctgatgtgtctgtt 29106856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 72
Target Start/End: Complemental strand, 22684333 - 22684296
Alignment:
35 cccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| ||||||||||||||||||||||||    
22684333 cccctatagtttttcccctttctgattttatggtcccc 22684296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 72
Target Start/End: Original strand, 22754735 - 22754772
Alignment:
35 cccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| ||||||||||||||||||||||||    
22754735 cccctatagtttttcccctttctgattttatggtcccc 22754772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 32733612 - 32733669
Alignment:
12 atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggt 68  Q
    ||||||||||||| || ||||| || ||||||||||| ||||||||||||||||||||    
32733612 atagttttaaacgagcaattttgcctcctatagtttttcccctttctgattttatggt 32733669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 32733995 - 32733938
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt 68  Q
    ||||||||||||| |||||||| |||| |||| ||||| |||||||||||||||||||    
32733995 atagttttaaacgagcgattttgccccctataattttctccctttctgattttatggt 32733938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 9961 - 10022
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||    
9961 atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc 10022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 72
Target Start/End: Complemental strand, 10322 - 10286
Alignment:
36 ccctatagttttccccctttctgattttatggtcccc 72  Q
    |||||||||||||||||||||||||||||||||||||    
10322 ccctatagttttccccctttctgattttatggtcccc 10286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0017
Description:

Target: scaffold0017; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 184894 - 184955
Alignment:
12 atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||    
184894 atagttttaaacgagcgattttgccacctatagttttccccctttctgattttatggtcccc 184955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 185273 - 185182
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| |||||||||||| ||||||||||||||||||||| || ||| | | ||| || |||||||||||    
185273 atagttttaaacgagcgattttgccccctatagttttccctctttctgattttatggtccccatgacatttagtgctaatatgtctgttttt 185182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0460 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0460
Description:

Target: scaffold0460; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 385 - 476
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| || ||| | | |||||| ||| |||||||    
385 atagttttaaacgagcgattttgccccctatagttttccccttttctgattttatggtccccgtgacatttagtgctgatatgtttgttttt 476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0460; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 758 - 703
Alignment:
16 ttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||| |||||||| ||||||||||||| | | ||||||||||||||||||||    
758 ttttaaacgagcgattttgcccctatagtttt-ctcatttctgattttatggtcccc 703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 38306 - 38397
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||| | |||||||| |||| |||||||||||| ||||||||||||||||||||| || ||| | | |||||| |||||||||||    
38306 atagttttaaatgagcgattttgccccctatagttttccctctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt 38397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 38670 - 38603
Alignment:
35 cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||||||||||||||||||||| ||| || || ||| | | |||||| ||| |||||||    
38670 cccctatagttttccccctttctgattttatagtctccatgacatttagtgctgatatgtgtgttttt 38603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0069 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0069
Description:

Target: scaffold0069; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 50505 - 50444
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| || ||||| |||| |||||||| |||||||||||||||||||||||||    
50505 atagttttaaacgagcaattttgccccctatagtttaccccctttctgattttatggtcccc 50444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0069; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 50128 - 50218
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt 102  Q
    ||||||||||||| |||||||| |||| | ||||||||||| |||||||||||||||||||  || ||| | | |||||| |||||||||||    
50128 atagttttaaacgagcgattttgccccctgtagttttcccc-tttctgattttatggtccctatgacatttagtgctgatatgtctgttttt 50218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 19675 - 19736
Alignment:
12 atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc 72  Q
    ||||||||||||| |||||||| |||| ||||||||  ||||||||| ||||||||||||||    
19675 atagttttaaacgagcgattttgccccctatagtttctcccctttctaattttatggtcccc 19736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University