View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_596 (Length: 230)
Name: NF10145A_low_596
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_596 |
 |  |
|
| [»] scaffold0029 (2 HSPs) |
 |  |  |
|
| [»] scaffold0017 (2 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
| [»] scaffold0069 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 21)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 2856581 - 2856793
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctgg-catctggcgctgatgtgtctgtttttatgtgcc |
109 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||||||||||||||||||||||| ||||| |||| | |||| || ||||||||||||||||||| ||| |
|
|
| T |
2856581 |
atagtttaaaacgttcgattttatcccctatagttttccccctttctgatttattggtcgcccttgacatccgg---tgatgtgtctgtttttatgcgcc |
2856677 |
T |
 |
| Q |
110 |
acgtgtgtaagtccatttttaaaatnnnnnnnnttgaattttttacatttttagaaaaggaggcacgtgagtgaggcctatgtgaccgttgcaaaaaggg |
209 |
Q |
| |
|
|||||| ||||| |||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2856678 |
acgtgt--aagtcaatttaaaaaaataaaaaaaaggaattttc-acatttttagaaaaggaggcacgtgagtgaggcctatgtgaccgttgcaaaaaggg |
2856774 |
T |
 |
| Q |
210 |
ataaaaatctgaaatccct |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2856775 |
ataaaaatctgaaatccct |
2856793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 24473767 - 24473676
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
24473767 |
atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
24473676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 37396763 - 37396854
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
37396763 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
37396854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 6198701 - 6198774
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
6198701 |
attttgcaccctatagttttaaacgagcgattttgccccctatagttttccccatttctgattttatggtcccc |
6198774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 15444646 - 15444585
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15444646 |
atagttttaaacgagcgattttatcccctatagttttccctctttctgattttatggtcccc |
15444585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 17431342 - 17431403
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17431342 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
17431403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 33727104 - 33727043
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33727104 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
33727043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 11 - 102
Target Start/End: Complemental strand, 16169607 - 16169515
Alignment:
| Q |
11 |
tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||| ||| || ||| | | |||||| ||||||||||| |
|
|
| T |
16169607 |
tatagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggttcccatgacatttagtgctgatatgtctgttttt |
16169515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 6199095 - 6199004
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||| || ||| | | ||||| ||||||||||| |
|
|
| T |
6199095 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatgatccccatgacatttagtgctgaaatgtctgttttt |
6199004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 16169216 - 16169287
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc |
70 |
Q |
| |
|
||||||||||| ||||||||||||| || |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
16169216 |
attttgcacctcatagttttaaacgagcaatttttccccctatagttttctccctttctgattttatggtcc |
16169287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 33726732 - 33726811
Alignment:
| Q |
24 |
gtgcgatttttcc-cctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
33726732 |
gtgcgattttgcctcctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
33726811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 41662564 - 41662667
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| |||||||||| |||||||| |||||||||| ||| || ||| | | |||||||||| ||| |
|
|
| T |
41662564 |
attttgcacctcatagttttaaacgagcgattttgccccctatagttttctccctttctaattttatggttcccatgacatttagtgctgatgtgtttgt |
41662663 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
41662664 |
tttt |
41662667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 20861637 - 20861576
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| || |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20861637 |
atagttttaaacgagcgattttgcctcctataattttccccctttctgattttatggtcccc |
20861576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9623557 - 9623648
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| || ||||| |||| |||||||||||| |||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
9623557 |
atagttttaaacgagcaattttgccccctatagttttccctttttctgattttatggtccccttgacatttagtgctgatatgtctgttttt |
9623648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 15444266 - 15444357
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||||||| ||||||||||||| || || ||| | | |||||| | ||||||||| |
|
|
| T |
15444266 |
atagttttaaacgagcgattttgctccctatagttttccccctttatgattttatggtctccatgacatttagtgctgatatctctgttttt |
15444357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 34498530 - 34498463
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
34498530 |
cccctatatttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
34498463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 34498177 - 34498237
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34498177 |
atagttttaaacgagcgattttgcaccctatagttt-ccccctttctgattttatggtcccc |
34498237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 37397144 - 37397083
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||| ||| |||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
37397144 |
atagttttaaacgagcgactttgccccctatagatttccccctttctgattttatggtcccc |
37397083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 24473422 - 24473489
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| || ||| | | | ||| |||||||||||| |
|
|
| T |
24473422 |
cccctatagtttcccccctttctgattttatggtccccatgacatttagtgatgacgtgtctgttttt |
24473489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 25439125 - 25439065
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
25439125 |
atagttttaaacgagcgattttgccctctatagttt-ccccctttttgattttatggtcccc |
25439065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 15442822 - 15442879
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
15442822 |
ttttaaacgtgcgattttgcaccctatccttttcccgctttgtgattttatggtcccc |
15442879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 49)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 35 - 179
Target Start/End: Original strand, 19007784 - 19007923
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgccacgtgtgtaagtccatttttaaaat |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
19007784 |
cccctatagttttccctctttctgatttgatggtcccccttgcatctggcgctgatgtgtctgtttttatgtgccatgtgtgtaagtcaattttaaaaa- |
19007882 |
T |
 |
| Q |
135 |
nnnnnnnnttgaattttttacatttttagaaaaggaggcacgtga |
179 |
Q |
| |
|
||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
19007883 |
----aaaattggaattttcacatttttagaaaaggaggcacgtga |
19007923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 12 - 129
Target Start/End: Complemental strand, 19008749 - 19008631
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgcca |
110 |
Q |
| |
|
||||||| |||||||| ||||| |||| |||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19008749 |
atagtttaaaacgtgcaattttgccccctataattttccccctttctgatttgatggtaccccttgcatctggcgctgatgtgtctgtttttatgtgcca |
19008650 |
T |
 |
| Q |
111 |
cgtgtgtaagtccattttt |
129 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
19008649 |
tgtgtgtaagtcaattttt |
19008631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9347181 - 9347272
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| | || ||| | |||||||||||||||||||| |
|
|
| T |
9347181 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccgcatgacatttagcgctgatgtgtctgttttt |
9347272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 21687466 - 21687375
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
21687466 |
atagttttaaacgagcgatttttccctctgtagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
21687375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 49317806 - 49317897
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
49317806 |
atagttttaaacgagcgattttaccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
49317897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 999524 - 999433
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||| |||||||||| |
|
|
| T |
999524 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgcgtctgttttt |
999433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 42611228 - 42611331
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| ||| || ||| | | | |||||||||||| |
|
|
| T |
42611228 |
attttgcacctcatagttttaaacgagcgattttgcctcctatagttttccccctttctgattttatggttcccatgacatttagtgttgatgtgtctgt |
42611327 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
42611328 |
tttt |
42611331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 48104733 - 48104824
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
48104733 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
48104824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 27172537 - 27172480
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27172537 |
gttttaaacgagcgattttgcccctatagttttccccctttctgattttatggtcccc |
27172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 4692432 - 4692341
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| || ||||||||||| |||||||||||||||||||||||| || ||| | | |||||||||||| ||||| |
|
|
| T |
4692432 |
atagttttaaacgagcgattttacctcctatagtttttcccctttctgattttatggtccccatgacatttagtgctgatgtgtctattttt |
4692341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 21687080 - 21687171
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
21687080 |
atagttttaaacgagcgattttgccccctatagttttcctcctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
21687171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 28634156 - 28634065
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
28634156 |
atagttttaaacgatcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
28634065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 42611625 - 42611522
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| | ||| | | |||||||||||||| |
|
|
| T |
42611625 |
attttgcacctcatagttttaaacaagcgattttgccccctatagtttttcccctttctgattttatggtccccataacatttagtgctgatgtgtctgt |
42611526 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
42611525 |
tttt |
42611522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50430080 - 50429989
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
50430080 |
atagttttaaacgagcgattttgccccctatagttttctccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
50429989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50526471 - 50526380
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| | || ||| | |||||||||||||||||| |
|
|
| T |
50526471 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccacatgacatttaatgctgatgtgtctgttttt |
50526380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50615620 - 50615529
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||| |||||||||| |
|
|
| T |
50615620 |
atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgcgtctgttttt |
50615529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 50623448 - 50623357
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | ||||||| |||||||||| |
|
|
| T |
50623448 |
atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgcgtctgttttt |
50623357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 6703503 - 6703576
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
6703503 |
attttgcacctcatagttttaaacgagcgattttgccccctatagttttccccttttctgattttatggtcccc |
6703576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 20480222 - 20480283
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20480222 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
20480283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 26814749 - 26814810
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26814749 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
26814810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 32163042 - 32162981
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccct-atagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32163042 |
atagttttaaacgagcgattttgccccttatagttttccccctttctgattttatggtcccc |
32162981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 48105115 - 48105054
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48105115 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
48105054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 49318165 - 49318077
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | ||||||||||||||| |
|
|
| T |
49318165 |
atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgtt |
49318077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 49318442 - 49318353
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||| ||| || ||| | | |||||||||||||||||| |
|
|
| T |
49318442 |
atagttttaaacgagcgattttatcccctatagttttccc--tttctgattttatggttcccatgacatttagtgctgatgtgtctgttttt |
49318353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 6703893 - 6703802
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| || | |||||||||||||||||||||||||||||||| | || ||| | | |||||| ||||||||||| |
|
|
| T |
6703893 |
atagttttaaacgagcgattttgcctcatatagttttccccctttctgattttatggtcctcatgacatttagtgctgatatgtctgttttt |
6703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 9347550 - 9347459
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | | |||||||||| ||||| |
|
|
| T |
9347550 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgttgatgtgtctattttt |
9347459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 44224118 - 44224059
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcc |
70 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44224118 |
atagttttaaacgagcgattttgtcccctatagttttacccctttctgattttatggtcc |
44224059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 46824277 - 46824186
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||| |||||||||||||||| || ||| | | ||||| ||||||||||| |
|
|
| T |
46824277 |
atagttttaaacgagcgattttgccccctatagttttccccctttttgattttatggtccccatgacatttagtgctgaaatgtctgttttt |
46824186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 50429699 - 50429801
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| |||||||||| |||||||||||||||||| ||| || ||| | | |||||||||||||| |
|
|
| T |
50429699 |
attttgcacctcatagttttaaacgagcgattttgccccctatagttttcatcctttctgattttatggt-cccatgacatttagtgctgatgtgtctgt |
50429797 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
50429798 |
tttt |
50429801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 13918501 - 13918559
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc |
69 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13918501 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtc |
13918559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 26815118 - 26815057
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
26815118 |
atagttttaaacgagcgattttgccccctataattttccccctttctgattttatggtcccc |
26815057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 28633775 - 28633832
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
28633775 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt |
28633832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 46823898 - 46823955
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
46823898 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt |
46823955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 20480623 - 20480552
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
20480623 |
attttgcaccctatagttttaaacgagcgatttc-cccctatagtgtttcccctttctgattttatggtcccc |
20480552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 66
Target Start/End: Original strand, 27172170 - 27172225
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatg |
66 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
27172170 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatg |
27172225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 13918878 - 13918805
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
13918878 |
attttgcacctcatagttttaaacgaacgattttgccccctatagttttccccccttttgattttatggtcccc |
13918805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 20371351 - 20371290
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| || ||||| |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
20371351 |
atagttttaaacgagcaattttgccccctatagtttaccccctttctgattttatggtcccc |
20371290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 4692064 - 4692163
Alignment:
| Q |
1 |
attttgca-cctatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
|||||||| |||||||||| ||||| || ||||| |||| |||||||| ||||||||||||||||||||| ||| || ||| | | |||||||||||||| |
|
|
| T |
4692064 |
attttgcatcctatagtttaaaacgagccattttgccccctatagttt-ccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgt |
4692162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 20371093 - 20371183
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| | ||||||||||| ||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
20371093 |
atagttttaaacgagcgattttgccccctgtagttttcccc-tttctgattttatggtccctatgacatttagtgctgatatgtctgttttt |
20371183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 72
Target Start/End: Original strand, 32162801 - 32162839
Alignment:
| Q |
34 |
tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32162801 |
tcccctatagtttttcccctttctgattttatggtcccc |
32162839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 44911083 - 44911137
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
44911083 |
gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggt |
44911137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 39691995 - 39691938
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| |||||| | |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39691995 |
ttttaaacgtgtgattttgcaccctatctttttccccctttctgattttatggtcccc |
39691938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 44911448 - 44911379
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||||||||| ||| |||| ||||| |||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
44911448 |
attttgcaccctattgtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt |
44911379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 44223745 - 44223797
Alignment:
| Q |
18 |
ttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc |
69 |
Q |
| |
|
||||||| |||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
44223745 |
ttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtc |
44223797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 999166 - 999256
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| | ||||||||||||||||||| || || ||| | | | | |||||||||||||| |
|
|
| T |
999166 |
atagttttaaacgagcgattttgccccctatagtttt-ctcctttctgattttatggtctccatgacatttagtgttaatgtgtctgttttt |
999256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 47498354 - 47498412
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtc |
69 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
47498354 |
atagttttaaacaagcgattttgccctctatagttttctccctttttgattttatggtc |
47498412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 50615289 - 50615343
Alignment:
| Q |
48 |
ccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
50615289 |
ccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt |
50615343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 50623117 - 50623171
Alignment:
| Q |
48 |
ccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
50623117 |
ccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt |
50623171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 50949561 - 50949507
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||| ||||| |||||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
50949561 |
gtttaaaacgagcgattttgccccctatagtttttcccctttctgattttatggt |
50949507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 24)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 115
Target Start/End: Original strand, 5378717 - 5378820
Alignment:
| Q |
13 |
tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgccac |
111 |
Q |
| |
|
|||||| |||||||||||||| |||| |||| ||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5378717 |
tagtttaaaacgtgcgattttgccccctatattttaccctctttctgatttgatggtccccctggcatctggcgctgatgtgtctgttttaatgtgccac |
5378816 |
T |
 |
| Q |
112 |
gtgt |
115 |
Q |
| |
|
|||| |
|
|
| T |
5378817 |
gtgt |
5378820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 115
Target Start/End: Complemental strand, 5379957 - 5379854
Alignment:
| Q |
13 |
tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttatgtgccac |
111 |
Q |
| |
|
|||||| |||||||||||||| |||| |||| ||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5379957 |
tagtttaaaacgtgcgattttgccccctatattttaccccctttctgatttgatggtccccctgacatctggcgctgatgtgtctgttttaatgtgccac |
5379858 |
T |
 |
| Q |
112 |
gtgt |
115 |
Q |
| |
|
|||| |
|
|
| T |
5379857 |
gtgt |
5379854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 26692819 - 26692728
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
26692819 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
26692728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 8851203 - 8851294
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | | |||| ||||||||||| |
|
|
| T |
8851203 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt |
8851294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 16911268 - 16911210
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtc |
69 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16911268 |
atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtc |
16911210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 5793490 - 5793563
Alignment:
| Q |
1 |
attttgca-cctatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5793490 |
attttgcatcctatagttttaaacgagcgattttgccccctatagttttccctctttctgattttatggtcccc |
5793563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 7664672 - 7664611
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7664672 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
7664611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 17851401 - 17851309
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttat |
104 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||| ||||||||||||| |
|
|
| T |
17851401 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt-cccatgacatttagtgctgatatgtctgtttttat |
17851309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 16910882 - 16910973
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||||||||||||||||| || ||| | | | |||| ||||||||||| |
|
|
| T |
16910882 |
atagttttaaacgagcgattttgccctctatagttttcctcctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt |
16910973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 6324972 - 6325033
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6324972 |
atagttttaaacgagcgattttgtcccctatagttttccctctttctgattttatggccccc |
6325033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 7664303 - 7664364
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
7664303 |
atagttttaaacgagcgattttgccccctataattttccccctttctgattttatggtcccc |
7664364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 7979620 - 7979711
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||| ||||||||||||||| |||| || ||| | | |||||| ||||||||||| |
|
|
| T |
7979620 |
atagttttaaacgagcgattttgccccctatagttttccctctttctgattttatgatccctatgacatttagtgctgatatgtctgttttt |
7979711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 19141848 - 19141765
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgt |
94 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||||||| |
|
|
| T |
19141848 |
atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgt |
19141765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 26692451 - 26692542
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| | ||||||| |||| |||||||||||||||||||||||| | ||| | |||||||||||||||||| |
|
|
| T |
26692451 |
atagttttaaacgagcgattttgctccctataatttttcccctttctgattttatggtccccaagacatttattgctgatgtgtctgttttt |
26692542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 7980002 - 7979941
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7980002 |
atagttttaaacgagcgatttcgccgcctatagtttttcccctttctgattttatggtcccc |
7979941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 8851581 - 8851521
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
8851581 |
atagttttaaacgagcgattttgccccctatagttttcccc-tttctgattttatggtcccc |
8851521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 6325358 - 6325286
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc |
71 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||| |||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
6325358 |
attttgcacctcatagtattaaacgagcgattttgccccctatagttttccccatttctgactttatggtccc |
6325286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 5378890 - 5378927
Alignment:
| Q |
191 |
gtgaccgttgcaaaaagggataaaaatctgaaatccct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5378890 |
gtgaccgttgcaaaaagggataaaaatctaaaatccct |
5378927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 228
Target Start/End: Complemental strand, 5379781 - 5379744
Alignment:
| Q |
191 |
gtgaccgttgcaaaaagggataaaaatctgaaatccct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5379781 |
gtgaccgttgcaaaaagggataaaaatctaaaatccct |
5379744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 37720259 - 37720307
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccctatagttttccccctttctgatt |
61 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
37720259 |
atagttttaaacgagcgattttgcccctatagtttt-cccctttctgatt |
37720307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Complemental strand, 18750102 - 18750048
Alignment:
| Q |
48 |
ccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||||||||||||||| || ||| | | |||||||||| ||||||| |
|
|
| T |
18750102 |
ccccctttctgattttatggtccccatgacatttagtgctgatgtgtttgttttt |
18750048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 41790548 - 41790602
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||| ||||| |||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41790548 |
gtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt |
41790602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 41790908 - 41790854
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||| ||||| |||||||| |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
41790908 |
gtttaaaacgagcgattttgccccctatagttttccctctttctgattttatggt |
41790854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 72
Target Start/End: Original strand, 17851056 - 17851093
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
17851056 |
cccctatagatttccccctttatgattttatggtcccc |
17851093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 30)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 53687943 - 53688036
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttat |
104 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | ||| |||||||||||||||||| |
|
|
| T |
53687943 |
atagttttaaacgagcgattttaccccctatagttttccccctttctgattttatggtccccatgacatttagcgttgatgtgtctgtttttat |
53688036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 3353562 - 3353460
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||| || ||| | | |||||||||||||| |
|
|
| T |
3353562 |
attttgcacctcatagttttaaacgagcgattttgccccctatagttt-ccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgt |
3353464 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
3353463 |
tttt |
3353460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 27238508 - 27238611
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || | | | | |||||| ||||||| |
|
|
| T |
27238508 |
attttgcaccctatagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacttttagtgctgatatgtctgt |
27238607 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
27238608 |
tttt |
27238611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 3353182 - 3353271
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| || ||| | | ||||||||||||||||| |
|
|
| T |
3353182 |
atagttttaaacgagcgatttc-cccctatagttttccccctttctgattttatggtccccatgacatttagtactgatgtgtctgttttt |
3353271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 22429213 - 22429274
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22429213 |
atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtcccc |
22429274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 22429595 - 22429504
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
22429595 |
atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
22429504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 36180609 - 36180700
Alignment:
| Q |
12 |
atagttttaaacgtgcgattttt-cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| || ||| | | | |||| ||||||||||| |
|
|
| T |
36180609 |
atagttttaaacgagcgattttgacccctatagttttccccctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt |
36180700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 40848575 - 40848636
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40848575 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
40848636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 42673295 - 42673234
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42673295 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
42673234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 11 - 102
Target Start/End: Original strand, 44008021 - 44008113
Alignment:
| Q |
11 |
tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||| ||| || ||| | | |||||| ||||||||||| |
|
|
| T |
44008021 |
tatagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggttcccatgacatttagtgctgatatgtctgttttt |
44008113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 10348538 - 10348625
Alignment:
| Q |
16 |
ttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||| |||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
10348538 |
ttttaaacgagcgattttgtcccctatagtttttcccctttctgattttatagtccccatgacatttagtgctgatatgtctgttttt |
10348625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 44008412 - 44008341
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc |
70 |
Q |
| |
|
||||||||||| ||||||||||||| || |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44008412 |
attttgcacctcatagttttaaacgagcaatttttccccctatagttttctccctttctgattttatggtcc |
44008341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 10348798 - 10348737
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
10348798 |
atagttttaaacgagcgattttgccccctatagttttccccctttctaattttatggtcccc |
10348737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 26007614 - 26007557
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26007614 |
ttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
26007557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 27238899 - 27238842
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
27238899 |
atagttttaaacgagcgattttgctccctatagttttccccctttctgattttatggt |
27238842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 48159952 - 48160013
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
48159952 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatgatcccc |
48160013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 26007236 - 26007327
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttccc-ctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| ||||||||||||||||||||| || ||| | | |||||| | ||||||||| |
|
|
| T |
26007236 |
atagttttaaacgagcgattttgccctctatagttttccatctttctgattttatggtccccatgacatttagtgctgatatatctgttttt |
26007327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 24485076 - 24485137
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24485076 |
atagttttaaacgagcgatttcgccccctatagtttttcccctttctgattttatggtcccc |
24485137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 36180989 - 36180928
Alignment:
| Q |
12 |
atagttttaaacgtgcgattttt-cccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
36180989 |
atagttttaaacgagcgattttttcccctatagtttttcccttttctgattttatgatcccc |
36180928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 40848960 - 40848899
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
40848960 |
atagttttaaacaagcgattttgccccctatagttttcaccctttctgattttatggtcccc |
40848899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 42456194 - 42456134
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
42456194 |
atagttttaaacgagcgattttgccccctatagttt-ccccctttctgattttatggtcccc |
42456134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 47666331 - 47666246
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
|||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | |||||||||| |||| |
|
|
| T |
47666331 |
gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtgtgtt |
47666246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 48160332 - 48160271
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
48160332 |
atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatgatcccc |
48160271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 42673032 - 42673123
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||||| ||||||||||| |||| || ||| | | |||||| |||| |||||| |
|
|
| T |
42673032 |
atagttttaaacgatcgattttgccccctatagttttccccctttatgattttatggcccccatgacatttagtgctgatatgtccgttttt |
42673123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 53688302 - 53688247
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatg |
66 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
53688302 |
atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatg |
53688247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 8314072 - 8314129
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||||||||||| | |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8314072 |
ttttaaacgtgcgattttgcaccctatcattttccccctttctgattttatggccccc |
8314129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 24485459 - 24485398
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
24485459 |
atagttttaaatgagcgattttgccccctatagtattccccctttctaattttatggtcccc |
24485398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 72
Target Start/End: Original strand, 42455852 - 42455885
Alignment:
| Q |
39 |
tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42455852 |
tatagttttccccctttctgattttatggtcccc |
42455885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 53766565 - 53766499
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
53766565 |
cccctatatttttcccc-tttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
53766499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 47665954 - 47666023
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||| || |||| ||||| | |||||| || ||||||||||||||||||| |||||||||||| |
|
|
| T |
47665954 |
attttgcacctcattgtttaaaacgagtgattttaccacctatagttttccccctttttgattttatggt |
47666023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 27)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 37888888 - 37888979
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
37888888 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
37888979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9034923 - 9035014
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
9034923 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt |
9035014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 10533089 - 10533180
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||| ||||||| |
|
|
| T |
10533089 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtttgttttt |
10533180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 17157022 - 17157113
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
17157022 |
atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
17157113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 18864022 - 18864113
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
18864022 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
18864113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 20419323 - 20419232
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
20419323 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccgtgacatttagtgctgatatgtctgttttt |
20419232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 37889258 - 37889167
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
37889258 |
atagttttaaacgagcgattttgccccctatagttttctccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
37889167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 9 - 102
Target Start/End: Original strand, 42418643 - 42418737
Alignment:
| Q |
9 |
cctatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||||||||||||| |||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
42418643 |
cctatagttttaaacgagcgattttgccccctatagttttccccctttctaattttatggtccccatgacatttagtgctgatatgtctgttttt |
42418737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 13744232 - 13744141
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||| |||||||||||||||| || || | | |||||||||||||||||| |
|
|
| T |
13744232 |
atagttttaaacgagcgattttgccccctatagttttccccctttttgattttatggtccccatgatatttagtgctgatgtgtctgttttt |
13744141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 37972395 - 37972304
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||| ||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
37972395 |
atagttttaaacgagcgattttgccccctatagttttccccctttcagattttatggtccccatgacatttagtgctgatatgtctgttttt |
37972304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 48359374 - 48359464
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
48359374 |
atagttttaaacgagcgattttaccccctatagttt-ccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
48359464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 102
Target Start/End: Complemental strand, 3205091 - 3205001
Alignment:
| Q |
13 |
tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | | |||||| ||||||||| |
|
|
| T |
3205091 |
tagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgttgatgtatctgttttt |
3205001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 18864413 - 18864340
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18864413 |
attttgcacctcatagttttaaaagagcgattttgccccctatagttttccccctttctgattttatggtcccc |
18864340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 22740211 - 22740272
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22740211 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
22740272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 38826924 - 38826823
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
||||||||||| ||||||||||||| || |||| |||| |||||||||||||||||||||||||||| ||||| || ||| | | |||||||||||||| |
|
|
| T |
38826924 |
attttgcacctcatagttttaaacgaacggttttgccccctatagttttccccctttctgattttatgatccccatgacatttagtgctgatgtgtctgt |
38826825 |
T |
 |
| Q |
99 |
tt |
100 |
Q |
| |
|
|| |
|
|
| T |
38826824 |
tt |
38826823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 42419027 - 42418966
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42419027 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
42418966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 36527797 - 36527739
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc |
69 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36527797 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtc |
36527739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 20418943 - 20419004
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
20418943 |
atagttttaaacgagcgattttgccccctatagttttcaccctttctgattttatggtcccc |
20419004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 29292980 - 29293065
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
|||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | | ||||||||||||||| |
|
|
| T |
29292980 |
gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgtt |
29293065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 37972015 - 37972076
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
37972015 |
atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtcccc |
37972076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 3204722 - 3204813
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| || ||||| |||| |||||||||||| ||||||||||||||||||||| || ||| | |||||||||||| ||||| |
|
|
| T |
3204722 |
atagttttaaacgagcaattttgccccctatagttttccctctttctgattttatggtccccatgacatttattgctgatgtgtctattttt |
3204813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 13741612 - 13741702
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||| |||||||| |||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
13741612 |
atagttttaaacgagcgattttgccccctatagttttcccactttctga-tttatggtccccgtgacatttagtgctgatctgtctgttttt |
13741702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 36527438 - 36527529
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccct-atagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| | ||||||||||| |||||||| ||||||||||||||||| |||||| || ||| ||| | |||||||||| ||||| |
|
|
| T |
36527438 |
atagttttaaacgatcaatttttccccttatagtttttcccctttctgattttatagtccccatgacatttggtgatgatgtgtctattttt |
36527529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 29293342 - 29293257
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
|||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| || ||| | ||||||||||||||| |
|
|
| T |
29293342 |
gtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggttcccatgacatttactgctgatgtgtctgtt |
29293257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 48359657 - 48359600
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
48359657 |
atagtttaaaacgagcgattttgccccctatagttttccccctttctgattttatggt |
48359600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 9035292 - 9035232
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttc-cccctttctgattttatggtcc |
70 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
9035292 |
atagttttaaacgagcgattttgccccctatagttttctcccctttctgattttatggtcc |
9035232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 22740590 - 22740500
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttc-ccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||| ||| ||||| |||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
22740590 |
atagttttaaacgagcgattttgctccctatagttttcccc-tttatgattctatggtccccatgacatttagtgctgatatgtctgttttt |
22740500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 24)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 41072225 - 41072122
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| ||||||||||||||||||| |||||||||||||| || ||| | | |||||||||||||| |
|
|
| T |
41072225 |
attttgcaccctatagttttaaacgagcgattttgccccctatagttttccccctttctaattttatggtccccatgacatttagtgctgatgtgtctgt |
41072126 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
41072125 |
tttt |
41072122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 22729062 - 22729122
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22729062 |
atagttttaaacgagcgattttgcccctatagttttccccctttctgattttatggtcccc |
22729122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 3888661 - 3888570
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
3888661 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt |
3888570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 12498927 - 12498836
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
12498927 |
atagttttaaacaagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
12498836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 19514581 - 19514672
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
19514581 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
19514672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 34147195 - 34147285
Alignment:
| Q |
13 |
tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||| ||||||||| |
|
|
| T |
34147195 |
tagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccgtgacatttagtgctgatgtatctgttttt |
34147285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 26570784 - 26570845
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26570784 |
atagttttaaacgagcgattttgtcccctatagttttccccctttctgattttatggtcccc |
26570845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 26571163 - 26571070
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtttttat |
104 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||||||||| || ||| | | |||||| ||||||||||||| |
|
|
| T |
26571163 |
atagttttaaacgagcgattttgccccctatagttttcctcctttctgattttatggtccccatgacatttagtgctgatatgtctgtttttat |
26571070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 43464203 - 43464130
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43464203 |
attttgcacctcatagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
43464130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 10098940 - 10098879
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10098940 |
atagttttaaacgagcgattttatcccctatagttttccctctttctgattttatggtcccc |
10098879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 25940564 - 25940637
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
25940564 |
attttgcaccctatagttttaaacgagcgattttgccccctatagttttcaccctttctgattttatggtcccc |
25940637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 34147521 - 34147448
Alignment:
| Q |
1 |
attttgcaccta-tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34147521 |
attttgcacctcgtagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
34147448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 71
Target Start/End: Original strand, 3888294 - 3888354
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc |
71 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3888294 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccc |
3888354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 22729439 - 22729379
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc |
71 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22729439 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccc |
22729379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 37780753 - 37780682
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| || |||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37780753 |
attttgcacctcattgttttaaacgagcgattttgcccctatagttt-ccccctttctgattttatggtcccc |
37780682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 12498622 - 12498679
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12498622 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggt |
12498679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 21207281 - 21207342
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
21207281 |
atagttttaaacgagcgattttgccccctatagttttcaccctttctgattttatggtcccc |
21207342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 72
Target Start/End: Complemental strand, 25940940 - 25940903
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25940940 |
cccctatagttttccccctttctgattttatggtcccc |
25940903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 37610629 - 37610557
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| || |||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
37610629 |
attttgcacctcattgttttaaacgagcgattttgccccctatagttt-ccccctttctgattttatggtcccc |
37610557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 2817208 - 2817294
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||| |||||||| |||| |||| |||||||| |||||||||||||||||||| || ||| | | | |||||||||||||||| |
|
|
| T |
2817208 |
ttttaaacgagcgattttgccccctatatttttcccc-tttctgattttatggtccccatgacatttagtgttgatgtgtctgttttt |
2817294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 11316970 - 11316912
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
|||||||| | |||||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
11316970 |
gttttaaatgagcgattttgccccctatagttttccctctttctgattttatggtcccc |
11316912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 68
Target Start/End: Complemental strand, 19514938 - 19514905
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19514938 |
cccctatagttttccccctttctgattttatggt |
19514905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 25941013 - 25940956
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccc-tttctgattttatgg |
67 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25941013 |
atagttttaaacgagcgattttgccccctatagttttcccccctttctgattttatgg |
25940956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 64
Target Start/End: Original strand, 43463810 - 43463863
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgatttta |
64 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
43463810 |
atagttttaaacgagcgattttgccccctatagttttctccctttctgatttta |
43463863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 30)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 23540263 - 23540160
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||||||| ||| |
|
|
| T |
23540263 |
attttgcaccctatagttttaaacgagcgattttaccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtgtgt |
23540164 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
23540163 |
tttt |
23540160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 25162312 - 25162221
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
25162312 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
25162221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 28196401 - 28196492
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
28196401 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttaatgctgatgtgtctgttttt |
28196492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 28196772 - 28196681
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | | | |||||||||||||||| |
|
|
| T |
28196772 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccatgacatttagtgatgatgtgtctgttttt |
28196681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 39086634 - 39086531
Alignment:
| Q |
1 |
attttgcaccta-tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| | || ||| | | |||||||||||||| |
|
|
| T |
39086634 |
attttgcacctaatagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtctgcatgacatttagtgctgatgtgtctgt |
39086535 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
39086534 |
tttt |
39086531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 32703281 - 32703371
Alignment:
| Q |
13 |
tagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
32703281 |
tagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtccccgtgacatttaatgctgatgtgtctgttttt |
32703371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 39912108 - 39912168
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39912108 |
atagttttaaacgaacgattttgcccctatagttttccccctttctgattttatggtcccc |
39912168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 169438 - 169347
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||| |||||||||||||||| || ||| | | | |||||||||||||||| |
|
|
| T |
169438 |
atagttttaaacgagcgattttgccccctatagttttccccctttttgattttatggtccccatgacatttagtgttgatgtgtctgttttt |
169347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 292837 - 292928
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| || ||||||||||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
292837 |
atagttttaaacgagcgattttgccccctacagttttccccctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
292928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 32703649 - 32703558
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| || ||| | | | |||||||||||||||| |
|
|
| T |
32703649 |
atagttttaaacgagcgattttgccccctatagttttccccttttctgattttatggtccccatgacatttagtgatgatgtgtctgttttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 39744464 - 39744373
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||| |||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
39744464 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttgtggtccccatgacatttagtgctgatatgtctgttttt |
39744373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 48406396 - 48406293
Alignment:
| Q |
1 |
attttgcacc-tatagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgt |
98 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| || ||| | ||| |||||||||| |
|
|
| T |
48406396 |
attttgcaccctatagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtccccatgacatttaatgcttatgtgtctgt |
48406297 |
T |
 |
| Q |
99 |
tttt |
102 |
Q |
| |
|
|||| |
|
|
| T |
48406296 |
tttt |
48406293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 9380740 - 9380679
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9380740 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
9380679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 169073 - 169160
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||||| || ||| | | | |||||||||||||||| |
|
|
| T |
169073 |
ttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtccccatgacatttagtgttgatgtgtctgttttt |
169160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 4239365 - 4239274
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| | | | |||| ||||||||||| |
|
|
| T |
4239365 |
atagttttaaacgagcgattttgccccctatatttttccccctttctgattttatggtccccatgacatttagtgttgatatgtctgttttt |
4239274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 9380362 - 9380421
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc |
70 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9380362 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcc |
9380421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 48406016 - 48406107
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||| |||||||||||||||| |||||||||||| || ||| | | | |||||||||||||||| |
|
|
| T |
48406016 |
atagttttaaacgagcgattttgccccctataattttccccctttctgactttatggtccccatgacatttagtgatgatgtgtctgttttt |
48406107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 293216 - 293155
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
293216 |
atagttttaaacgagcgattttgccccgtatagttttccccctttctgattttatggccccc |
293155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 9023679 - 9023618
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9023679 |
atagttttaaatgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
9023618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 12757821 - 12757882
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
12757821 |
atagttttaaacgagcgattttgtcccctatagtttttcctctttctgattttatggtcccc |
12757882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 25161933 - 25161994
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
25161933 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattgtatggtcccc |
25161994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 39744089 - 39744146
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39744089 |
ttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
39744146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 12758203 - 12758143
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc |
71 |
Q |
| |
|
||||||||||||| || ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12758203 |
atagttttaaacgagcaattttgccccctatagttttccccctttctgattttatggtccc |
12758143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 44468934 - 44468862
Alignment:
| Q |
1 |
attttgcacct-atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccc |
71 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
44468934 |
attttgcacctcatagttttaaacgagcgattttgccccctatagttttcctcctttctgattttatgatccc |
44468862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 9023299 - 9023390
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| | |||||| |||| ||||||||||||||||| |||||||||||||||| || ||| | |||||| ||||||||||| |
|
|
| T |
9023299 |
atagttttaaacgagtgattttgccccctatagttttccccctttatgattttatggtccccatgacatttaatgctgatatgtctgttttt |
9023390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 43292092 - 43292151
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcc |
70 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
43292092 |
atagttttaaacgagcgattttgccccctatagtttttcccctttctgattttatggtcc |
43292151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 43292356 - 43292302
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttt-tcccctatagttttccccctttctgattttatg |
66 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
43292356 |
atagttttaaacgagcgattttgccccctatagtttt-cccctttctgattttatg |
43292302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 26207418 - 26207472
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||| ||||| |||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26207418 |
gtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt |
26207472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 26207742 - 26207688
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
|||| ||||| |||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26207742 |
gtttaaaacgagcgattttgccccctatagttttcctcctttctgattttatggt |
26207688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 96
Target Start/End: Original strand, 23539918 - 23539979
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtct |
96 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| ||| || ||| | | |||||||||||| |
|
|
| T |
23539918 |
cccctatatttttcctcctttctgattttatggttcccatgacatttagtgctgatgtgtct |
23539979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 14)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 7654523 - 7654456
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||| | | |||||||||||||||||| |
|
|
| T |
7654523 |
cccctatagttttccccctttctgattttatggtccccatgacatttagtgctgatgtgtctgttttt |
7654456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 33974298 - 33974207
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| || || ||| | | |||||| ||||||||||| |
|
|
| T |
33974298 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtctccatgacatttagtgctgatatgtctgttttt |
33974207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 2354466 - 2354551
Alignment:
| Q |
15 |
gttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
|||| ||||| ||||||||||||| |||||||||||||||||||||||||||||| ||| || ||| | | ||||||||||||||| |
|
|
| T |
2354466 |
gtttaaaacgagcgatttttccccctatagttttccccctttctgattttatggttcccatgacatttagtgctgatgtgtctgtt |
2354551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 10087857 - 10087799
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtc |
69 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10087857 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtc |
10087799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 13177055 - 13176994
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccct-atagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
13177055 |
atagttttaaacgagcgattttgccccttatagttgtccccctttctgattttatggtcccc |
13176994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 13176698 - 13176765
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
13176698 |
cccctatagttttcccactttctgattttatggtccccgtgacatttagtgctgatatgtctgttttt |
13176765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 22755088 - 22754998
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||| ||||||||||||| |||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
22755088 |
atagttttaaacgagcgattttgccccctatagttttcccc-tttctgattttattgtccccatgacatttagtgctgatatgtctgttttt |
22754998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 29074371 - 29074283
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||| ||||||||||||||||| | ||| || ||| | | ||||||||||||||| |
|
|
| T |
29074371 |
atagtttaaaacgagcgattttcccccctatagttttcgccctttctgattttatgattcccatgacatttagtgctgatgtgtctgtt |
29074283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 29079135 - 29079047
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||| ||||||||||||||||| | ||| || ||| | | ||||||||||||||| |
|
|
| T |
29079135 |
atagtttaaaacgagcgattttcccccctatagttttcgccctttctgattttatgattcccatgacatttagtgctgatgtgtctgtt |
29079047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 29106944 - 29106856
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgtt |
99 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||| ||||||||||||||||| | ||| || ||| | | ||||||||||||||| |
|
|
| T |
29106944 |
atagtttaaaacgagcgattttcccccctatagttttcgccctttctgattttatgattcccatgacatttagtgctgatgtgtctgtt |
29106856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 72
Target Start/End: Complemental strand, 22684333 - 22684296
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22684333 |
cccctatagtttttcccctttctgattttatggtcccc |
22684296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 72
Target Start/End: Original strand, 22754735 - 22754772
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22754735 |
cccctatagtttttcccctttctgattttatggtcccc |
22754772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 32733612 - 32733669
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||||| || ||||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
32733612 |
atagttttaaacgagcaattttgcctcctatagtttttcccctttctgattttatggt |
32733669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 32733995 - 32733938
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggt |
68 |
Q |
| |
|
||||||||||||| |||||||| |||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
32733995 |
atagttttaaacgagcgattttgccccctataattttctccctttctgattttatggt |
32733938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 9961 - 10022
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9961 |
atagttttaaacgagcgattttgccccctatagttttccccctttctgattttatggtcccc |
10022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 72
Target Start/End: Complemental strand, 10322 - 10286
Alignment:
| Q |
36 |
ccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10322 |
ccctatagttttccccctttctgattttatggtcccc |
10286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 184894 - 184955
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcc-cctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
184894 |
atagttttaaacgagcgattttgccacctatagttttccccctttctgattttatggtcccc |
184955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 185273 - 185182
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||| ||||||||||||||||||||| || ||| | | ||| || ||||||||||| |
|
|
| T |
185273 |
atagttttaaacgagcgattttgccccctatagttttccctctttctgattttatggtccccatgacatttagtgctaatatgtctgttttt |
185182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 385 - 476
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||||| |||||||||||||||||||| || ||| | | |||||| ||| ||||||| |
|
|
| T |
385 |
atagttttaaacgagcgattttgccccctatagttttccccttttctgattttatggtccccgtgacatttagtgctgatatgtttgttttt |
476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 758 - 703
Alignment:
| Q |
16 |
ttttaaacgtgcgatttttcccctatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
758 |
ttttaaacgagcgattttgcccctatagtttt-ctcatttctgattttatggtcccc |
703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 38306 - 38397
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||| | |||||||| |||| |||||||||||| ||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
38306 |
atagttttaaatgagcgattttgccccctatagttttccctctttctgattttatggtccccatgacatttagtgctgatatgtctgttttt |
38397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 38670 - 38603
Alignment:
| Q |
35 |
cccctatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || || ||| | | |||||| ||| ||||||| |
|
|
| T |
38670 |
cccctatagttttccccctttctgattttatagtctccatgacatttagtgctgatatgtgtgttttt |
38603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 50505 - 50444
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| || ||||| |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
50505 |
atagttttaaacgagcaattttgccccctatagtttaccccctttctgattttatggtcccc |
50444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 50128 - 50218
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtccccctggcatctggcgctgatgtgtctgttttt |
102 |
Q |
| |
|
||||||||||||| |||||||| |||| | ||||||||||| ||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
50128 |
atagttttaaacgagcgattttgccccctgtagttttcccc-tttctgattttatggtccctatgacatttagtgctgatatgtctgttttt |
50218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 19675 - 19736
Alignment:
| Q |
12 |
atagttttaaacgtgcgatttttcccc-tatagttttccccctttctgattttatggtcccc |
72 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
19675 |
atagttttaaacgagcgattttgccccctatagtttctcccctttctaattttatggtcccc |
19736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University