View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_609 (Length: 230)
Name: NF10145A_low_609
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_609 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 39781181 - 39780958
Alignment:
| Q |
1 |
ttattttcaaattgatcttcacattttgtttaagtgttaatttgatgggtttgaattgaaaagttatataaaataacatattcataaattttctgctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
39781181 |
ttattttcaaattgatcttcacattttgtttaagtgttaatttgatgggtttgaattgaaaagttatataaaataacatattcataaaatttttgctatt |
39781082 |
T |
 |
| Q |
101 |
agctatagctatttataatattagaggtttagggagttcagacnnnnnnnnnnnnggaaattcttaagcttgttaagcatatcgtttgtggattttatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39781081 |
agctatagctatttataatattagaggtttagggagttcagagaaaaaaaaaaaaggaaattcttaagcttgttaagcatatcgtttgtggattttatgt |
39780982 |
T |
 |
| Q |
201 |
attcagttattcggttgtctgttg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39780981 |
attcagttattcggttgtctgttg |
39780958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University