View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_610 (Length: 230)

Name: NF10145A_low_610
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_610
NF10145A_low_610
[»] chr3 (1 HSPs)
chr3 (188-230)||(18039121-18039163)
[»] chr1 (1 HSPs)
chr1 (188-229)||(44320105-44320146)


Alignment Details
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 230
Target Start/End: Complemental strand, 18039163 - 18039121
Alignment:
188 cacttaaggctgtccctttccgaaaccaaatgaggtactttcg 230  Q
    |||||||||||||||||||||||||||||||||||||||||||    
18039163 cacttaaggctgtccctttccgaaaccaaatgaggtactttcg 18039121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 229
Target Start/End: Original strand, 44320105 - 44320146
Alignment:
188 cacttaaggctgtccctttccgaaaccaaatgaggtactttc 229  Q
    ||||||||| |||||||||| |||||||||||||||||||||    
44320105 cacttaaggttgtccctttcggaaaccaaatgaggtactttc 44320146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University