View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_610 (Length: 230)
Name: NF10145A_low_610
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_610 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 230
Target Start/End: Complemental strand, 18039163 - 18039121
Alignment:
| Q |
188 |
cacttaaggctgtccctttccgaaaccaaatgaggtactttcg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18039163 |
cacttaaggctgtccctttccgaaaccaaatgaggtactttcg |
18039121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 229
Target Start/End: Original strand, 44320105 - 44320146
Alignment:
| Q |
188 |
cacttaaggctgtccctttccgaaaccaaatgaggtactttc |
229 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44320105 |
cacttaaggttgtccctttcggaaaccaaatgaggtactttc |
44320146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University