View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_612 (Length: 230)
Name: NF10145A_low_612
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_612 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 22055368 - 22055600
Alignment:
| Q |
1 |
tgcatccaaacctactattgtattataactattatataattcctctatagttgaatattattatcaggaacttagtgaacctagttaaatgtatga--ta |
98 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
22055368 |
tgcatccaaacctactatcgtattataactattatataattcctctatagttgaatattattatcaggaacttagtaaacctagttaaatgtatgatttt |
22055467 |
T |
|
| Q |
99 |
aattttttggttttgctgctcac---ttactaatctannnnnnngcttgacattacaccttattatagatgtatgcattaaatttgcagctgcaccttga |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22055468 |
ttttttttggttttgctgctcactgtttactaatgtatttttttgcttgacattacaccttattatagatgtatgcattaaatttgcagctgcaccttga |
22055567 |
T |
|
| Q |
196 |
tatttttatgtcccctcaataacctctcaatgt |
228 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
22055568 |
tatttttatgtcccctcagtaacctctcaatgt |
22055600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University