View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_620 (Length: 229)
Name: NF10145A_low_620
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_620 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 34142580 - 34142475
Alignment:
| Q |
124 |
tactggattctgtctcacggataactctgttcgattgtagagttgccaaagccaaatgttatcaagggagagattaatcaagatattaaaagtcactttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142580 |
tactggattctgtctcacggataactctgttcgattgtagagttgccaaagccaaatgttattaagggagagattaatcaagatattaaaagtcactttg |
34142481 |
T |
 |
| Q |
224 |
aaactg |
229 |
Q |
| |
|
|||||| |
|
|
| T |
34142480 |
aaactg |
34142475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University