View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_626 (Length: 229)
Name: NF10145A_low_626
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_626 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 225
Target Start/End: Complemental strand, 33791189 - 33790971
Alignment:
| Q |
7 |
agatggacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacgtggtccacctgctaagacaactgaatctcttgttgcta |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33791189 |
agatgtacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaacagaatctcttgttgcta |
33791090 |
T |
|
| Q |
107 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgagggtatatcctcttacagtaaggtttgc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33791089 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
33790990 |
T |
|
| Q |
207 |
tcttgctgctttctatgat |
225 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
33790989 |
tcttgctgctttctctgat |
33790971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 33 - 147
Target Start/End: Original strand, 33764098 - 33764212
Alignment:
| Q |
33 |
taatccatcacgtcttcctgtaggaacattgtaacgtggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgcacatgaaact |
132 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| |||||| || | |||| | || | ||||||||| || | || || ||||||||||||||||| |
|
|
| T |
33764098 |
taatccgtcacgtcttcctgtaggaatattgtattttggtcctccagataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaacc |
33764197 |
T |
|
| Q |
133 |
gttgatggacatgca |
147 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33764198 |
gttgatggacatgca |
33764212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University