View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_631 (Length: 229)
Name: NF10145A_low_631
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_631 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 33121298 - 33121526
Alignment:
| Q |
1 |
tcgattggactagatgacctaaaatggcgaggttatttacacggttgatggcttagacgctcaatagcaggtagtaggtacctttagggg-gtgatccac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33121298 |
tcgattggactagatgacctaaaatggcaaggttgtttatacggttgatggcttagacgctcaatagcaggtagtaggtacctttaggggggtgatccac |
33121397 |
T |
 |
| Q |
100 |
gtgagtggttcgtagggacgttgacctcttaggggtattgtcccgtcttctccgacaggattgcgacgagggagtatcattttggccattttatccgacc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33121398 |
gtgagtggttcgtagggacgttgacctcttaggggtaatgtcctgtcttctccgacaagattgcgacgagggattatcattttggccattttatccgacc |
33121497 |
T |
 |
| Q |
200 |
caacccttacgctgtgtggtgacacttgg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33121498 |
caacccttacgctgtgtggtgacacttgg |
33121526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University