View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_635 (Length: 229)
Name: NF10145A_low_635
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_635 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 4055130 - 4054910
Alignment:
| Q |
8 |
cataacagtaatatctttgtttctctgtttctcttcccctacaacattgatatgtctttctaaacaccaacgttaaacaaaacaaaatttgtttcagaat |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055130 |
cataacagtgatatctttgtttctctgtttctcttccccaacaacattgatatgtctttctaaacaccaacgttaaacaaaacaaaatttgtttcagaag |
4055031 |
T |
 |
| Q |
108 |
acactctttgtttcgaagtgtgactgtgttt-atgtgtttttctctcgaagtgtctacacaaagtaaaatccgaatagggttattgggtcggtgggtcgg |
206 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4055030 |
acactctttgtttcgaagtttcactgtgtttaatgtgtttttctctcgaactgtctacacaaagtaagatccgaatagggttattgggtcggtgggtcgg |
4054931 |
T |
 |
| Q |
207 |
gtcatcatattcttggacatc |
227 |
Q |
| |
|
|||||| | || ||||||||| |
|
|
| T |
4054930 |
gtcatcgttttattggacatc |
4054910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University