View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_636 (Length: 229)
Name: NF10145A_low_636
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_636 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 21056583 - 21056783
Alignment:
| Q |
17 |
atgaagatctcgaaggtgaatatgaatcatacaattttatacattatgcaacatgcacctgaattttatacagtatacatttcttgatatttaggcgctg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
21056583 |
atgaagatctcgaaggtgaatatgaatcatacaattttatacattatgcaacatgcacctgaattttatacagtatacatttcttgatatttaagcattg |
21056682 |
T |
 |
| Q |
117 |
tttaatttacattaaatcgcttgagaaaaatgcttctcttgcacctgtattttgatttactcgacatcatttcnnnnnnnattactaaaaggtgatgtcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||| |
|
|
| T |
21056683 |
tttaatttacattaaatcgcttgagaaaaatgcttctcttgcacctgtattttgatttactcgacatcgtttctttttttattactaaaaggtgatctcc |
21056782 |
T |
 |
| Q |
217 |
a |
217 |
Q |
| |
|
| |
|
|
| T |
21056783 |
a |
21056783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 92 - 189
Target Start/End: Complemental strand, 26365350 - 26365252
Alignment:
| Q |
92 |
tacatttcttgatatttaggcgctgtttaatttacattaaatcgcttgagaaaaatgcttctcttg--cacctgtattttgatttactcgacatcatttc |
189 |
Q |
| |
|
|||||||||||||||||||| | || |||||| ||||| ||||| |||||||| |||||||| ||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
26365350 |
tacatttcttgatatttaggtgttgattaattcacattgaatcgtttgagaaacatgcttct-ttgcacacctgtattttgatttacttgacgtcatttc |
26365252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University