View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_653 (Length: 226)
Name: NF10145A_low_653
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_653 |
 | |
|
| [»] scaffold0018 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0018 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 34873 - 34648
Alignment:
| Q |
1 |
tattgaaactgttgatgaagcacaaatttggttgggtttttaatgcccctgtggatgtggttaagttgaatattcccgactatttcagtgtcataacgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
34873 |
tattgaaactgttgatgaagcacaaatttggttgggtttttaatgcccctgtggatgtggttaagttgaatattcctgactatttcagtgtgataacgca |
34774 |
T |
|
| Q |
101 |
tcctatggatttgggaacagtacaaaacaagattgctaaaggatcatacacaggcccattggaatttgctgctgatgtgaggcttacattttcaaatgcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34773 |
tcctatggatttgggaacagtacaaaacaagattgctaaaggatcatacacaggcccattggaatttgctgctgatgtgaggcttacattttcaaatgcg |
34674 |
T |
|
| Q |
201 |
ttgagttataatccacctaagactga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34673 |
ttgagttataatccacctaagactga |
34648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 217
Target Start/End: Complemental strand, 47172 - 46984
Alignment:
| Q |
29 |
tggttgggtttttaatgcccctgtggatgtggttaagttgaatattcccgactatttcagtgtcataacgcatcctatggatttgggaacagtacaaaac |
128 |
Q |
| |
|
|||||||||||| || ||||||||||||| || |||||||| |||| || ||||||| | |||| | | | |||||||||||||||||| || ||| | |
|
|
| T |
47172 |
tggttgggttttcaacacccctgtggatgtagtcaagttgaaccttcctgattatttcactatcattaaggaacctatggatttgggaacaataaaaagc |
47073 |
T |
|
| Q |
129 |
aagattgctaaaggatcatacacaggcccattggaatttgctgctgatgtgaggcttacattttcaaatgcgttgagttataatccacc |
217 |
Q |
| |
|
||||| | | || | ||| | | ||||||||||||||||| ||| ||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
47072 |
aagatcgatgccagagcgtactctgacccattggaatttgctggtgacgtgaggcttacgttttcgaatgcaatgacctataatccacc |
46984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 115
Target Start/End: Original strand, 34066404 - 34066494
Alignment:
| Q |
25 |
aatttggttgggtttttaatgcccctgtggatgtggttaagttgaatattcccgactatttcagtgtcataacgcatcctatggatttggg |
115 |
Q |
| |
|
||||||||||||||||||||| || || ||||| ||||| ||||| ||||| || ||||||| |||||| | ||||| ||||||||||| |
|
|
| T |
34066404 |
aatttggttgggtttttaatgaaccagtcgatgttgttaaattgaacattccggattatttcaatgtcatcaaacatccaatggatttggg |
34066494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University