View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_658 (Length: 225)
Name: NF10145A_low_658
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_658 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 210
Target Start/End: Complemental strand, 26325034 - 26324830
Alignment:
| Q |
6 |
aatgagatggacatcattatatatatgtcaaagaggtgcaattgacggttaattaccgttggaaaattgcatgaagtcgtttcagtttgtttattttgaa |
105 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26325034 |
aatgagatggaaattattatatatatgtcaaagaggtgcaattgacggttaattaccgttggaaaattgcatgaagtcgtttcagtttgtttattttgaa |
26324935 |
T |
 |
| Q |
106 |
acgtggttattttttatttgggatttgcaaataaaaccaagaaacacgacttttcaaatttattatcagttgattaccgttagatactattgtggtcata |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26324934 |
acgtggttattttttatttgggatttgcaaataaaaccaagaaacacgacttttcaaatttattatcagttgattaccgttagatactattgtggtcata |
26324835 |
T |
 |
| Q |
206 |
ttgtt |
210 |
Q |
| |
|
||||| |
|
|
| T |
26324834 |
ttgtt |
26324830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 35 - 92
Target Start/End: Original strand, 48320850 - 48320906
Alignment:
| Q |
35 |
aaagaggtgcaattgacggttaattaccgttggaaaattgcatgaagtcgtttcagtt |
92 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
48320850 |
aaagaggtgcaattggcggttaattaccgtttgaaaa-tgcatgaagtcgtttcagtt |
48320906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University