View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_660 (Length: 225)

Name: NF10145A_low_660
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_660
NF10145A_low_660
[»] chr4 (1 HSPs)
chr4 (1-225)||(16161022-16161246)


Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 16161246 - 16161022
Alignment:
1 caacaatgtgaattataaacaaatggacaaactaataagaggatagtagtttaaatatggacctctaagagataaatggcgttgcataattttacttcga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16161246 caacaatgtgaattataaacaaatggacaaactaataagaggatagtagtttaaatatggacctctaagagataaatggcgttgcataattttacttcga 16161147  T
101 tgaggttaacaaaaggaaagcaataaagaagatagagccacaaaaatataaatgtagatgtaaataaaaacactgctaaattaagcatacagtggagaat 200  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||    
16161146 tgaggttaacaaaaggaaagcaataaagaagataaagccacaaaaatataaatgtagatgtaaataaaaacactgctaaattaagcatacggcggagaat 16161047  T
201 aaggtggatttattccaaataacag 225  Q
    |||||||||||||||||||||||||    
16161046 aaggtggatttattccaaataacag 16161022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University