View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_671 (Length: 223)
Name: NF10145A_low_671
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_671 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 15250238 - 15250437
Alignment:
| Q |
16 |
atgattggcaacggtttttgttgtttgggggacctggtggattctgtggtctttgaaacatgtggttgtagatgatattggtcagaatgactttaattta |
115 |
Q |
| |
|
|||||| |||||| || |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15250238 |
atgatttgcaacgtgttgtgttgtttggtggacctggtggattctgtggtctttaaaacatgtggttgtagatgatattggtcagaattactttaattta |
15250337 |
T |
 |
| Q |
116 |
ataaatgtatcatgggttctattttgtttcaaagtgatgatagttaata----ttatttactgttagcatgatgcactaaaaagttaaaacaacaccaaa |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
15250338 |
ataaatgtgtcatgggttctattttgtttcaaag---tgatagttaatattatttatttactgttagcatgatgcactaaaaagttaaaacaacgctaaa |
15250434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University