View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_672 (Length: 223)
Name: NF10145A_low_672
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_672 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 21 - 207
Target Start/End: Complemental strand, 7012418 - 7012231
Alignment:
| Q |
21 |
tgttgaatatagatgtgcaggggacatgcaagtatggaacaagggtggattatattttgggttcatcaaa-tcaccatacaaatttgttccagggtcata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7012418 |
tgttgaatatagatgtgcaggggacatgcaagtatggaacaagggtggattatattttgggttcatcaaaatcaccatacaaatttgttccagggtcata |
7012319 |
T |
 |
| Q |
120 |
ctcagtaatttcttctaaaggaacttctgatcaccacattgtgaaggtagatataatgaaagtaaatacttcaactcagaataatgta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012318 |
ctcagtaatttcttctaaaggaacttctgatcaccacattgtgaaggtagatataatgaaagtaaatacttcaactcagaataatgta |
7012231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University