View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_675 (Length: 222)
Name: NF10145A_low_675
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_675 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 6164364 - 6164460
Alignment:
| Q |
3 |
atcaattcatatatcttgatttgtttcattattaggccatagatttcaagatttatgaagtgaaataatcaacaatacaggaagaaggatggggatt |
99 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
6164364 |
atcaatgcatatatcttgagttgtttcattattaggccattgatttcaagatttatgaagtgaaataatcaacaagacaggaggatggatggggatt |
6164460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 96
Target Start/End: Original strand, 6139049 - 6139142
Alignment:
| Q |
3 |
atcaattcatatatcttgatttgtttcattattaggccatagatttcaagatttatgaagtgaaataatcaacaatacaggaagaaggatgggg |
96 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
6139049 |
atcaatgcatatatcttgagttgtttcattattaggccatagatttcaagatttataaattgaaataatcaacaagacaggaagatggatgggg |
6139142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 3 - 96
Target Start/End: Complemental strand, 13283051 - 13282953
Alignment:
| Q |
3 |
atcaattcatatatcttgatttgtttcattattaggccatagatttcaagatttatgaagtgaaa-----taatcaacaatacaggaagaaggatgggg |
96 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
13283051 |
atcaatgcatatatcttgagttgttttattattaggccatagatttcaagatttatgaagtgaaatggagtaatcaacaagacaggaagatggatgggg |
13282953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University