View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_678 (Length: 222)
Name: NF10145A_low_678
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_678 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 9 - 213
Target Start/End: Original strand, 24422148 - 24422351
Alignment:
| Q |
9 |
agatggacatcaatgtgacagaaattaaggttgaaaatggaagagatagagacggaaagttatacggttttttctgttagaaagaatgttacaaaatttg |
108 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24422148 |
agatgaacattaatgtgacagaaattaaggttgaaaatggaagagatagagacagaaagttatacggttttttctgttagaaagaatgttacaaaatttg |
24422247 |
T |
|
| Q |
109 |
gagaaaacggcgttggtgcgttaccaataacatttaagaaattggacggctaagatggatggtaagagaggattggacggttgagatttgatattattgg |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24422248 |
gagaaaac-gcgttggtgcgttaccaataacatttaagaaattggacgactaagatggatggtaagagaggattggacggttgagatttgattttattgg |
24422346 |
T |
|
| Q |
209 |
agatc |
213 |
Q |
| |
|
|||| |
|
|
| T |
24422347 |
tgatc |
24422351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University