View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_680 (Length: 221)
Name: NF10145A_low_680
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_680 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 23 - 206
Target Start/End: Original strand, 46844530 - 46844713
Alignment:
| Q |
23 |
ccgtgtctgtcttattacatcaaaggaaagtatgatttgctaatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46844530 |
ccgtgtctgtcttattacatcaaaggaaagtataatttgctaatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatga |
46844629 |
T |
 |
| Q |
123 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46844630 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatgttgtt |
46844713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 199
Target Start/End: Complemental strand, 48986 - 48942
Alignment:
| Q |
155 |
ggggtgagatggcattttgcagccatgaatgccgtgaccagagga |
199 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
48986 |
ggggtgagatggcattttgcaaccctgaatgccgtaaccagagga |
48942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University