View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_683 (Length: 221)
Name: NF10145A_low_683
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_683 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 30364854 - 30365074
Alignment:
| Q |
1 |
gatatgaatccaaataatttgttgatccgacctaatggacagctgaaacttgcagattttggtttagcgcgtatttttggacgcccggatcgcaggttca |
100 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
30364854 |
gatatgaaaccaaataatttgttgatcggacctaatggacaactgaaacttgcagattttggtttagcgcgtatttttggaagcccagatcgcaggttca |
30364953 |
T |
|
| Q |
101 |
ctcatcaggtttgtttttcatatttagtatcatgagaatccctttcagaatgtgggagtaagcacgtagacaactttggaatttgttaaaaaatctgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30364954 |
ctcatcaggtttgtttttcatatttagtatcatgagaatccctttcagaatgtgggagtaagcacgtagacaactttggaatttgttagaaaatctgtgt |
30365053 |
T |
|
| Q |
201 |
taattgtggtaggccaccgct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30365054 |
taattgtggtaggccaccgct |
30365074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 66
Target Start/End: Complemental strand, 21439091 - 21439030
Alignment:
| Q |
5 |
tgaatccaaataatttgttgatccgacctaatggacagctgaaacttgcagattttggttta |
66 |
Q |
| |
|
|||| ||||| || |||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21439091 |
tgaaaccaaacaacttgttgataggacaaaatggacagctgaaacttgcagattttggttta |
21439030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University