View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_684 (Length: 221)
Name: NF10145A_low_684
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_684 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 20454325 - 20454545
Alignment:
Q |
1 |
atgaagggtgttgttggtagggggagtaaggattgggatttaaatgattggagatgggatggtgatctttttacggctaagcaattgaattcggtgccga |
100 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
20454325 |
atgaagggtgctgttggtagggggagtaaggattgggatttgaatgattggagatgggatggtgatctttttactgctaagcaactgaattcggtgccga |
20454424 |
T |
 |
Q |
101 |
cggattgtaggaatcgtcaatatttacccgaaatacgtgaaaatgttgatgtttcgaataatttggtttctggtgaaggaagtagagagttggagaagcg |
200 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||| | |
|
|
T |
20454425 |
cggattgtaggaatcgtcaatttttacccgaaatacgtgaaaatgttgatgtttcgaataatttgatttctggggaaggtagtagagagttggagaagag |
20454524 |
T |
 |
Q |
201 |
gaggaggggttttggtggtga |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
20454525 |
gaggaggggttttggtggtga |
20454545 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University