View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_690 (Length: 219)
Name: NF10145A_low_690
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_690 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 26 - 201
Target Start/End: Complemental strand, 54261348 - 54261173
Alignment:
| Q |
26 |
cacagagcgaaacaagtaattaagagtttgatctttcaaacttttgctaatttcctttactcttataaattagtaaacaattgaactttgaatactgaga |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261348 |
cacagagcgaaacaagtaattaagagtttgatccttcaaacttttgctaatttcctttactcttataaattagtaaacaattgaactttgaatactgaga |
54261249 |
T |
 |
| Q |
126 |
acacaagatatacgccctatctggataaacagcttaatttgcaattataacttatgcgcttatgtattagctattt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54261248 |
acacaagatatacgccctatatggataaacagcttaatttgcaattataacttatgcgcttatgtattagctattt |
54261173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University