View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_693 (Length: 218)
Name: NF10145A_low_693
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_693 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 6307377 - 6307200
Alignment:
| Q |
23 |
aagtacaggaaaggtaagaagttgatttctttgtctgcaattttataggtatacatgatccaagaacaaaatgagtgaaagatgtgcacgggggtttgaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307377 |
aagtacaggaaaggtaagaagttgatttctttgtctgcaattttataggtatacatgatccaagaacaaaatgagtgaaagatgtgcacgggggtttgaa |
6307278 |
T |
|
| Q |
123 |
aatatgtataactttttatcattacttagccaagttcattgaactctaatgagaaacagttttgtgcggttagatatt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6307277 |
agtatgtataactttttatcattacttagccaagttcattgaactctaatgagaaacagttttgtgcagttagatatt |
6307200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University