View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_695 (Length: 218)
Name: NF10145A_low_695
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_695 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 43895948 - 43896133
Alignment:
| Q |
15 |
acatcaatattttttataaattaattatatttgtagacatctactaatatatctggaggcatatggttttataaatnnnnnnnntaaaatctggaggcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43895948 |
acatcaatattttttataaattaattatatttgtagatatctactaatatatctggaggcatatggttttataaataagaaa---aaaatctggaggcat |
43896044 |
T |
 |
| Q |
115 |
ggtaaaaacttgtaaaaattgactaatatcaccgacgcttggtagattgatttggcttaatcggtaagtatgtatatcgctatattttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43896045 |
ggtaaaaacttgtaaaaattgactaatatcaccgacgcttgggagattgatttggctagatcggtaagtatgtatatcgctatattttt |
43896133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University