View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_699 (Length: 218)
Name: NF10145A_low_699
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_699 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 32193480 - 32193683
Alignment:
| Q |
1 |
tcaaggcattctagaaggatcagaactggtaatgcaggagccacaatctgttaggcatgagctgcaattacataaagtgagaaaggggacgaagcatcag |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32193480 |
tcaaggcattctagaaagatcagaactggtaatgcaggagccacaatctgttaggcatgagctgcaattacataaagtgagaaaggggacgaagcatcgg |
32193579 |
T |
 |
| Q |
101 |
attcctagtacaaaactcaaaggtttttattgctataggtataaatggagtgaggattaagaatgtgggtgtggataatctgtgtagaaatttctgttca |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32193580 |
attcctagtacaaagctcaaaggtttttattgctataggtataaatggagtgaggattaagaatgtgggtgtggataatttgtgtagaaatttctgttct |
32193679 |
T |
 |
| Q |
201 |
tctc |
204 |
Q |
| |
|
|||| |
|
|
| T |
32193680 |
tctc |
32193683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University