View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_701 (Length: 217)
Name: NF10145A_low_701
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_701 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 30641477 - 30641363
Alignment:
| Q |
18 |
tggtgttgccgtttcttctctttgttcaggtttcttctcttcttttgagtgaataacacacgtatgcgcagcttcactcttcgttcaatgatagactgaa |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
30641477 |
tggtgttgccgtttcttctccttgttcaggtttcttctcttcttttgagtgaataacacacgtatacgcagcttcactcttcgttcaataatcgactgaa |
30641378 |
T |
|
| Q |
118 |
cctt-aacttcttct |
131 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
30641377 |
ccttcaacttcttct |
30641363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 3185811 - 3185764
Alignment:
| Q |
60 |
ttttgagtgaata-acacacgtatgcgcagcttcactcttcgttcaat |
106 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||| |||||| |
|
|
| T |
3185811 |
ttttgagtgaatacacacacatatgcgcagcttcactcttcattcaat |
3185764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 28071145 - 28071099
Alignment:
| Q |
60 |
ttttgagtgaataacacacgtatgcgcagcttcactcttcgttcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28071145 |
ttttgagtgaataacacacgtatgcgcagcttcactcttcattcaat |
28071099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 106
Target Start/End: Complemental strand, 14435173 - 14435140
Alignment:
| Q |
73 |
acacacgtatgcgcagcttcactcttcgttcaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
14435173 |
acacacgtatgcgcagcttcactcttcattcaat |
14435140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 7839845 - 7839817
Alignment:
| Q |
18 |
tggtgttgccgtttcttctctttgttcag |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7839845 |
tggtgttgccgtttcttctctttgttcag |
7839817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University