View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_705 (Length: 217)
Name: NF10145A_low_705
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_705 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 83 - 217
Target Start/End: Original strand, 41786026 - 41786160
Alignment:
| Q |
83 |
gatgaggatttggatagcctcggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgcgaccggtgtaactatctaatga |
182 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41786026 |
gatgaggatttggatagccttggggagaagaagagggaagcaataagacagctttgtttggttgttgagtttcatcgcgaccggtgtaactatctaatga |
41786125 |
T |
|
| Q |
183 |
atttggtcgcaagtatgagagttaataagaagaca |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
41786126 |
atttggtcacaagtatgagagttaataagaagaca |
41786160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University