View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_708 (Length: 215)
Name: NF10145A_low_708
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_708 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 32350879 - 32351097
Alignment:
| Q |
1 |
caagaacacattgttttttgtttgacaaggtaacacatatcgagctcgggcctagttgaaaatttatgagaatggattggaggaccttg------tggac |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32350879 |
caagaacacattgttttttgtttgacaaggtaaca--tatcgagctcgggcctagttgaaaatttatgagaatggattggaggaccttgctagggtggac |
32350976 |
T |
|
| Q |
95 |
atggtttggttcacgaggaaaaccaaaccaaattgaaccggattcttttcaaaactcataataattgaaatgaaccctttgcattttaatccggaccaaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350977 |
atggtttggttcacgaggaaaaccaaaccaaattgaaccggattcttttcaaaactcataataattgaaatgaaccctttgcattttaatccggaccaaa |
32351076 |
T |
|
| Q |
195 |
ttgctatttataatggttcgg |
215 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
32351077 |
ttgctattcataatggttcgg |
32351097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University