View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_709 (Length: 215)
Name: NF10145A_low_709
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_709 |
 |  |
|
[»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 35140 - 35346
Alignment:
Q |
1 |
attgaaggttgtctcaagttggctatttgaccactgttgatattaatatcactagaagatgacaaagtaacactatttctcttttgcatttgaaatttct |
100 |
Q |
|
|
|||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
35140 |
attgaaggttttctcaagttgtctatttgaccacggttgatattaatatcactagaagacgacaaagtaacaccatttctcttttgcatttgaaatttct |
35239 |
T |
 |
Q |
101 |
tttgaaaaagtcgaacccgttcaagctcagacttaaacctattggcaacttgttttctttgaaaagctgacaattttgacaaaggaacaagttgcattgg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35240 |
tttgaaaaagtcgaacccgttcaagctcagacttaaacctattggcaacttgttttctttgaaaagctgacaattttgacaaaggaacaagttgcattgg |
35339 |
T |
 |
Q |
201 |
aacacca |
207 |
Q |
|
|
||||||| |
|
|
T |
35340 |
aacacca |
35346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University