View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_710 (Length: 215)
Name: NF10145A_low_710
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_710 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 21 - 195
Target Start/End: Original strand, 35489744 - 35489918
Alignment:
| Q |
21 |
cctgcagatcggacatcaagagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaaga |
120 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489744 |
cctgcagatcggacttcaagagagcatatttcactgggaactaaccatcccagcgcaccccaagaccatgcaaatgccgcaacatatagacatataaaga |
35489843 |
T |
 |
| Q |
121 |
ctcagagaagatcagcctcggtttttgtaaacgagccttcaccgctaactccaagtttgatagcactcatacttc |
195 |
Q |
| |
|
|| ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35489844 |
ctaagagaagatcagcttcagtttttgtaaacgagccttcaccgctaactccaagtttgatagcaatcatacttc |
35489918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 120
Target Start/End: Complemental strand, 14233181 - 14233100
Alignment:
| Q |
39 |
agagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaaga |
120 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
14233181 |
agagcgcatatttcactaggcactaaccaacccaatggtccccaagaccatgcaaatgccgcaacatatgcacaaataaaga |
14233100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 39 - 120
Target Start/End: Complemental strand, 14242855 - 14242774
Alignment:
| Q |
39 |
agagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaaga |
120 |
Q |
| |
|
|||| ||||| ||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
14242855 |
agagcgcatacttcactaggcactaaccaacccaatggtccccaagaccatgcaaatgccgcaacatatgcacaaataaaga |
14242774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University